Hermansky-Pudlak syndrome 5 (HPS5) - 202 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.39342
gtaagttgtcctgtatattgtttatatgagctaaagcacatgcatttttttgtgtatttt  c.2561+60

         .         .         .         .   g.39383
agtctctaacatgttactcatttgcatatgaggcagcttct  c.2561+101

--------------------- middle of intron ---------------------
       g.39384      .         .         .         .           g.39424
       c.2562-101  gttagtatatttattttcatttgtaataagtaacctaaatg  c.2562-61

.         .         .         .         .         .           g.39484
taaccaagttatataatttcactgaaattagagactaaagtgttttgtttttaaatgcag  c.2562-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center