Hermansky-Pudlak syndrome 5 (HPS5) - 824 nt intron 18 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.39700
gtgagaaggagagcatatttgcagactctcctttcttttgacagggcattgtttctcttt  c.2717+60

         .         .         .         .         .         .  g.39760
tataagcaggtgtcacattgtgtactgttaattaccaaggggttgaggcacatactatgg  c.2717+120

         .         .         .         .         .         .  g.39820
aagaggaggatttgggaggccttgtaacattctgccacatgtcacagcacacatcacaaa  c.2717+180

         .         .         .         .         .         .  g.39880
tgtgcatgtaccacacttcttcactgcctctcagggattctcagatcagtgcaaaattaa  c.2717+240

         .         .         .         .         .         .  g.39940
tcccttgattcagggcctgaactaagaagataagcttcttattgtctttgcagtgagtag  c.2717+300

         .         .         .         .         .         .  g.40000
attcactgccacctttttattgacatagatctcagttccagctcttctctttttaggctg  c.2717+360

         .         .         .         .         .    g.40052
atgtctgattttctgtctccccatggttgtaacacttgtgacctgtgcccct  c.2717+412

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.40104
        ggcttattagactagcggcttcctcctttcttcttttgattggttcacattt  c.2718-361

.         .         .         .         .         .           g.40164
gccacaatgttgcccaggctggatgcagtggctattcacgggtatgatcatagcatacta  c.2718-301

.         .         .         .         .         .           g.40224
cagcctcaaacttatggcctcagtgatcttcctactctggccacactggtttttatttgt  c.2718-241

.         .         .         .         .         .           g.40284
ctctttctttctctctctctttctctccctttttttttttcttttttggccctttgacat  c.2718-181

.         .         .         .         .         .           g.40344
tttctttgttatcttggagcttggtcaccagcatttctagacattttgtagcagaagagt  c.2718-121

.         .         .         .         .         .           g.40404
tttcaagttatttcttcttctatattcatctcttaatcaggttttcttcacactccccac  c.2718-61

.         .         .         .         .         .           g.40464
attttatgcttcctttcttagcatgaagattggtgacttttttccccaactttctcttag  c.2718-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center