Hermansky-Pudlak syndrome 5 (HPS5) - 1131 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.40644
gtacagaagaagtcctctttctttgtttttttctttactttttttttttgagacaggatc  c.2837+60

         .         .         .         .         .         .  g.40704
tcactctgtcgcctaggctggaatgtggtgctaagatcatggcttcctgcagccttgacc  c.2837+120

         .         .         .         .         .         .  g.40764
tcctaggctcaggtgattaaacccttcaaccttagcttcctgagtagctgggaagacagg  c.2837+180

         .         .         .         .         .         .  g.40824
agcacaccactctgcccggctaattttttgtacagatgagatttcgccttatggcccagg  c.2837+240

         .         .         .         .         .         .  g.40884
ctggtctcgatctcctgggctcaagcgatctacctgccttggcctcacaaagtgctggga  c.2837+300

         .         .         .         .         .         .  g.40944
ttagaggcgtgagccactgtgcctggctaggagtcttatttctaaggattaagctccagt  c.2837+360

         .         .         .         .         .         .  g.41004
gttcctttggaatggaactggtttattcacatatggcattctgggctcactttagaaata  c.2837+420

         .         .         .         .         .         .  g.41064
gctatggaagagactgacccaagtcatggtagtaatgagattaagtatatttcttagtgg  c.2837+480

         .         .         .         .         .         .  g.41124
ttctgaaattttttggggtcaccctataagaatctgatgattccttttagaaaaatgcag  c.2837+540

         .         .        g.41150
tcatgcaaaactttgcacagctgacc  c.2837+566

--------------------- middle of intron ---------------------
                       g.41151          .         .           g.41175
                       c.2838-565  gcctgcaggtttttcatgggcccac  c.2838-541

.         .         .         .         .         .           g.41235
attaagagaccttggtgattaagcctgtgagaggataaaactgggtgtgggggttaggga  c.2838-481

.         .         .         .         .         .           g.41295
gataggtatgtatgtgttttcttcctaaaaatgtgtcaaggaatttttagacataacctg  c.2838-421

.         .         .         .         .         .           g.41355
atctaggactttaaaaataaaataaaattaaagtacacactggtacttgtgtcagaacta  c.2838-361

.         .         .         .         .         .           g.41415
ttgcttgcgtttcctcccaggagaagcttcttaaaagacccccaaatgcctgtcttatat  c.2838-301

.         .         .         .         .         .           g.41475
tcctagcaaaaagtctggaaggatatgcagtggttatctgtgagtgatggaatgatagaa  c.2838-241

.         .         .         .         .         .           g.41535
ttaaaagaagaaaaaagaatttatttcttttgcttttgattacctaaagtatctaatctt  c.2838-181

.         .         .         .         .         .           g.41595
taaaaataaacaggttataggaaaaatagctatttttaagttttcaaaagccaaatagca  c.2838-121

.         .         .         .         .         .           g.41655
atgtttttaaaatgtagtaatagaatgcagttaaactctattcttacctattaggtgata  c.2838-61

.         .         .         .         .         .           g.41715
aataagcattttctagagtttatttcctatctaatttactgattccttttcatttcatag  c.2838-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center