Hermansky-Pudlak syndrome 5 (HPS5) - 1444 nt intron 20 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.41889
gtaagtgagaattttttagaaactgaagttaaggttagaaacatttcagttaacaacttt  c.2951+60

         .         .         .         .         .         .  g.41949
atagttaagggtctgaattaatacacattaatatttggggattctctttgctatttaaaa  c.2951+120

         .         .         .         .         .         .  g.42009
gtacctttttgttttaagtgatagtaaattaaacatcttttttccatttaaatttcttgc  c.2951+180

         .         .         .         .         .         .  g.42069
ttttttcttttttttttttttttaaatagccttagctaattcccctccactccctctgct  c.2951+240

         .         .         .         .         .         .  g.42129
tagttgccagccccagttctcaggcatgtagatagtatttaattaagcaccagattatgt  c.2951+300

         .         .         .         .         .         .  g.42189
gataccaattataattgatagacttttataattaatacagtaagagagagatcaaaatgg  c.2951+360

         .         .         .         .         .         .  g.42249
gctcaatagcatcgctggtgaaggactcaaggaggaggtgagattttggaggtaaaacct  c.2951+420

         .         .         .         .         .         .  g.42309
aaaacctgggtaggatttgtatttataaaggagccaggagagggtgagttaggtgagaga  c.2951+480

         .         .         .         .         .         .  g.42369
aacagagcaagggcgtggaaaactggcattgcttattatccatgtcacacttcagtcagt  c.2951+540

         .         .         .         .         .         .  g.42429
tatttattgcctggtgatactggcttatggctccaactggattataatcttttggagata  c.2951+600

         .         .         .         .         .         .  g.42489
gcaacttgtgtctttcttttccctcataatgtctatatctaatttgtatagtggtaggca  c.2951+660

         .         .         .         .         .         .  g.42549
cttgatacatatttgttcattgtaatgagggctgagtctggccaggtggtgggtgacaag  c.2951+720

    g.42551
at  c.2951+722

--------------------- middle of intron ---------------------
                                              g.42552         g.42553
                                              c.2952-722  ca  c.2952-721

.         .         .         .         .         .           g.42613
tgcaggaccttgaaagctggtagaataatttagttatcagtagagacccttttagactga  c.2952-661

.         .         .         .         .         .           g.42673
actacttggtgcaaaaattgtgtaatgaaagtggagctttctagagatcatttctgatgt  c.2952-601

.         .         .         .         .         .           g.42733
catatatgagaaggctggagacagaaggccagctaggaagctgttggagtaattcagata  c.2952-541

.         .         .         .         .         .           g.42793
tgagtggattggtgattagtagggcagcaaaaggagcacatccagtgggcatttcaaagg  c.2952-481

.         .         .         .         .         .           g.42853
aaaatgcagtgggacatgctgatactggatatagcaaatgaaggagggggaagagtcaag  c.2952-421

.         .         .         .         .         .           g.42913
gaagacttccaaggtttacatatttggagaagaaatatgctaggtttgtgttgaatttta  c.2952-361

.         .         .         .         .         .           g.42973
aagtttataaattgaataaagcttaaatgccttataattggagcttggcctcaaatgtca  c.2952-301

.         .         .         .         .         .           g.43033
gcatttgttgctaggttttttgttttttttttttccctagatcagggtcatctaatagaa  c.2952-241

.         .         .         .         .         .           g.43093
ctttctgtgatagtggagatattctactgaactgtccaatggtggccactagccacatgt  c.2952-181

.         .         .         .         .         .           g.43153
agccattgactacttgaaatgtgaatatattaactgaaaaactgactttcagatgttatt  c.2952-121

.         .         .         .         .         .           g.43213
tacttttaattaatttaaattgaaatagccacatgtgactgtgtctactgttttgggcag  c.2952-61

.         .         .         .         .         .           g.43273
cacagctccagataaattcatggccttttattcctttcttcaacttcggtctctttaaag  c.2952-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center