Hermansky-Pudlak syndrome 5 (HPS5) - 1574 nt intron 21 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.43440
gtatgtcaatcctaactggttactcttggttgtcaatttttagaagttactccagacctc  c.3058+60

         .         .         .         .         .         .  g.43500
tcaacaaaaaaatttggtgaacctttcaatgatcatatatttaatatgtgattccactta  c.3058+120

         .         .         .         .         .         .  g.43560
gttgtcacatttgtggagtttttgtttttgtttttgttttttacctatagcccttgatat  c.3058+180

         .         .         .         .         .         .  g.43620
gttatgaaatcacaattaagaataaactataggcaacttttctatttcatgagtgcctac  c.3058+240

         .         .         .         .         .         .  g.43680
tatgtgttaggcactatactgtgtgctttccatatgttgttttaaatgagataacaaact  c.3058+300

         .         .         .         .         .         .  g.43740
ctggggatagttactattatttccactttccagataactgaggtacagaagggacagtta  c.3058+360

         .         .         .         .         .         .  g.43800
attggcccaaagtcacacagctactaattgtaaatgctggagctggggttcagaccaagg  c.3058+420

         .         .         .         .         .         .  g.43860
acttcctccaaaatttgtgcttaggctcttttttttttttttttttaatttcccattaat  c.3058+480

         .         .         .         .         .         .  g.43920
taaagatgattctggccaggcgcggtggctcacgcttgtaattccagcactttcagaggc  c.3058+540

         .         .         .         .         .         .  g.43980
cgaggtgggcagatcacctgaggtcgggagtttgagaccagcctggccaacatggtgaaa  c.3058+600

         .         .         .         .         .         .  g.44040
ccccatctctactaaaaatacaaaaattaactgggcatggtggcttatgcttgtaatccc  c.3058+660

         .         .         .         .         .         .  g.44100
agctacttgagaggctgaggcaggagaattgcttgaacctgggaggtggaggttgcagtg  c.3058+720

         .         .         .         .         .         .  g.44160
agctgagatcgcaccactgcactccagcttgggcaacagagcaagacttggtctcaaaac  c.3058+780

         g.44167
aaaaagg  c.3058+787

--------------------- middle of intron ---------------------
                                         g.44168              g.44174
                                         c.3059-787  aaaagaa  c.3059-781

.         .         .         .         .         .           g.44234
aaattccttgaattcgtcaagttctttcctgtgtcacattgtcttccatgtttcctttat  c.3059-721

.         .         .         .         .         .           g.44294
cagaaatgcaggccccttatttctgatggctcctactccaagttttcacattatgtgggc  c.3059-661

.         .         .         .         .         .           g.44354
cccatgcatatgtcctctaagcttgtctcatcttttagctttctgcttcaatgtcacttc  c.3059-601

.         .         .         .         .         .           g.44414
ctcatagagcccttctcagatcttccaggcagaatcagccattctctctgatgcttcctt  c.3059-541

.         .         .         .         .         .           g.44474
gttcttttttttcatagtgcttagcatactttataagtatatacttacgtgtttaagttt  c.3059-481

.         .         .         .         .         .           g.44534
tgtctcctatactagactgtaggctccacaagagtacagggattgtgtctcttctgttca  c.3059-421

.         .         .         .         .         .           g.44594
tcattacatatccagtgcttagcataggatatgccctgggtaattactgagtggttgaaa  c.3059-361

.         .         .         .         .         .           g.44654
gaattctgaagctgcccaggtgtggtagctcatgcctgtaatcccagcactttgggaggc  c.3059-301

.         .         .         .         .         .           g.44714
tgcggtgggaggcttgcttgagctcaggagtttaagaccagcctgggcaacatggtagtg  c.3059-241

.         .         .         .         .         .           g.44774
agaccctgtctctctttaaaaaaaaaaaagaaaaaaattaaagttaattttgtggcttct  c.3059-181

.         .         .         .         .         .           g.44834
ctttctcatgaacaatttatacaacaaattttcagaaaacaacttgtgttagggtgatga  c.3059-121

.         .         .         .         .         .           g.44894
gattgtgttcttgaatatttttacgttttggcattaaacattttcacagttttgaccatc  c.3059-61

.         .         .         .         .         .           g.44954
tcctgtatccagtcagtgtgctaagagtggtcaaactgacacttccctgtgtgtgtttag  c.3059-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center