Hermansky-Pudlak syndrome 5 (HPS5) - 2007 nt intron 22 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.45285
gtaatatcagtttgtcctaccctctgcatagtgcttggagaaggtagaaggccacagact  c.3329+60

         .         .         .         .         .         .  g.45345
ttcagatgtagatgtggagatcatttagtcccgacccatcactaacatgaggagactgag  c.3329+120

         .         .         .         .         .         .  g.45405
actgatgtggtaattaagggaagaggctaaagtaatatttcattcacagccatgaccaag  c.3329+180

         .         .         .         .         .         .  g.45465
atgctgttcagattaacctgaataatctgatgtgtccttgattctttaaaaatattactg  c.3329+240

         .         .         .         .         .         .  g.45525
gtaccaggctggtcgtggtggttcacgcctgtaatccttgcactttgtgaggccgaggtg  c.3329+300

         .         .         .         .         .         .  g.45585
ggcggatcatgaggtcaagagattgagaccatcctggcaacatggtgaaaccccatctct  c.3329+360

         .         .         .         .         .         .  g.45645
actaaaaaaaaaaagtacaaaaattagctgggtgtggtggcacgtgcctgtagtcccagc  c.3329+420

         .         .         .         .         .         .  g.45705
tacttgggaggctgaggcaggagaatcgcttgaactcggaaggtggaggttgcagtgagc  c.3329+480

         .         .         .         .         .         .  g.45765
caagaacatgacactgtactctagcctggtgacagagcgagactccatctcaaaaacaaa  c.3329+540

         .         .         .         .         .         .  g.45825
aaaattactggtacctggctgggtacggtggcttatgcctgtaatcccagtacttgggga  c.3329+600

         .         .         .         .         .         .  g.45885
ggctgaggcaggtggataacctgaggtcaggagttcgagaccagcctaaccaatatggtg  c.3329+660

         .         .         .         .         .         .  g.45945
aaaccctgtctctactaaaaaaaaaaaaaaaaaatgcaaaaaaattaactggacatggtg  c.3329+720

         .         .         .         .         .         .  g.46005
gcagacacttgtaattcccagctactcgggaagctgaggcaggagaatcgcttgaactca  c.3329+780

         .         .         .         .         .         .  g.46065
gcaggcagagattgcagtgagccaagatcacgccattgcactccaccctgggcaacaaga  c.3329+840

         .         .         .         .         .         .  g.46125
gcaaaactctgaaaaaaaaaaaaaaaattactggtaccagatacctaatgtctcagtaat  c.3329+900

         .         .         .         .         .         .  g.46185
ttttttttgtggtataatacacataaaatttatcatcttaacaatttaaaaatattcagc  c.3329+960

         .         .         .         .      g.46229
tcagtggtattaagttattcatattgttttgcatccagtctcta  c.3329+1004

--------------------- middle of intron ---------------------
    g.46230         .         .         .         .           g.46272
    c.3330-1003  gaactttttcattttgcaaaactgaaactccacacccattaaa  c.3330-961

.         .         .         .         .         .           g.46332
cagcaacttacttcctctacctagcccctggcaaccacagttctactttctgtttttatt  c.3330-901

.         .         .         .         .         .           g.46392
aattttactattctacatacctcatctcagtggaattaatacatttgtcgttttgtgacc  c.3330-841

.         .         .         .         .         .           g.46452
agcctgttttcactgagcatagcatcctaaaggtttatccatgttgtagcatgtgtcagg  c.3330-781

.         .         .         .         .         .           g.46512
atttcctttctacttaaggctgaataatattccgttgtatatatatgccaccttttgttt  c.3330-721

.         .         .         .         .         .           g.46572
atccattcatctgttgacagacacttgaattgcttccactttctggctattgtgaataac  c.3330-661

.         .         .         .         .         .           g.46632
gctgctatgaatatgagtatacaaatatgtcttccagacactgctttcagttctttcggg  c.3330-601

.         .         .         .         .         .           g.46692
tatatacctgaaagtggaattctggaatcatatggtaattctatttttaattttttgagg  c.3330-541

.         .         .         .         .         .           g.46752
aaccaccatactgttctgtagagactgcaccattttactttcctgccagcagtgcacaag  c.3330-481

.         .         .         .         .         .           g.46812
agttccaatttctccatgtgctagccccacacttgtcattttctgttgttgttttttgtt  c.3330-421

.         .         .         .         .         .           g.46872
aaacagtagctatcccagtgggtgtcaggtactatatatctcattgtggttttgatttgc  c.3330-361

.         .         .         .         .         .           g.46932
atttttctaatgattagagatgttgagcattttttcatatgcttattgaccatttatata  c.3330-301

.         .         .         .         .         .           g.46992
attgtctttggagaaatagctattcaagtcctttgcccatgttgaatcaggttgggtgtt  c.3330-241

.         .         .         .         .         .           g.47052
ttcgttgttgttgctgtaagagttctctgatattctggatattaacctcttatcagatac  c.3330-181

.         .         .         .         .         .           g.47112
atgatttgcaaatattttcttccattctgtaggttgccttttcactctgtgcattgtgtc  c.3330-121

.         .         .         .         .         .           g.47172
ttttaatgcacagaatcagtcaactttttgaatcctctgaaactctgtagtttttaagtt  c.3330-61

.         .         .         .         .         .           g.47232
ttctgtgaagaatgaacaatgacaactaaatttgcttgtttcttttctttgggatttcag  c.3330-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center