v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_005343.2 in the HRAS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007666.1, covering HRAS transcript NM_005343.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5008
                                                     tgccctgc       c.-181

 .         .         .         .         .         .                g.5068
 gcccgcaacccgagccgcacccgccgcggacggagcccatgcgcggggcgaaccgcgcgc       c.-121

 .         .         .         .         .         .                g.5128
 ccccgcccccgccccgccccggcctcggccccggccctggccccgggggcagtcgcgcct       c.-61

 .       | 02 .         .         .         .         .             g.6228
 gtgaacg | gtggggcaggagaccctgtaggaggaccccgggccgcaggcccctgaggagcg    c.-1

          .         .         .         .         .         .       g.6288
 ATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACC       c.60
 M  T  E  Y  K  L  V  V  V  G  A  G  G  V  G  K  S  A  L  T         p.20

          .         .         .         .         .  | 03      .    g.6615
 ATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAG | GATTCCTAC    c.120
 I  Q  L  I  Q  N  H  F  V  D  E  Y  D  P  T  I  E   | D  S  Y      p.40

          .         .         .         .         .         .       g.6675
 CGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGC       c.180
 R  K  Q  V  V  I  D  G  E  T  C  L  L  D  I  L  D  T  A  G         p.60

          .         .         .         .         .         .       g.6735
 CAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGT       c.240
 Q  E  E  Y  S  A  M  R  D  Q  Y  M  R  T  G  E  G  F  L  C         p.80

          .         .         .         .         . | 04       .    g.6948
 GTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAG | GGAGCAGATC    c.300
 V  F  A  I  N  N  T  K  S  F  E  D  I  H  Q  Y  R  |  E  Q  I      p.100

          .         .         .         .         .         .       g.7008
 AAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTG       c.360
 K  R  V  K  D  S  D  D  V  P  M  V  L  V  G  N  K  C  D  L         p.120

          .         .         .         .         .         .       g.7068
 GCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCC       c.420
 A  A  R  T  V  E  S  R  Q  A  Q  D  L  A  R  S  Y  G  I  P         p.140

          .         .         . | 05       .         .         .    g.7825
 TACATCGAGACCTCGGCCAAGACCCGGCAG | GGAGTGGAGGATGCCTTCTACACGTTGGTG    c.480
 Y  I  E  T  S  A  K  T  R  Q   | G  V  E  D  A  F  Y  T  L  V      p.160

          .         .         .         .         .         .       g.7885
 CGTGAGATCCGGCAGCACAAGCTGCGGAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGC       c.540
 R  E  I  R  Q  H  K  L  R  K  L  N  P  P  D  E  S  G  P  G         p.180

          .         .         .                                 g.7915
 TGCATGAGCTGCAAGTGTGTGCTCTCCTGA |                                  c.571
 C  M  S  C  K  C  V  L  S  X                                    p.189

       | 06  .         .         .         .         .         .    g.8083
 cgcag | cacaagctcaggacatggaggtgccggatgcaggaaggaggtgcagacggaagga    c.*60

          .         .         .         .         .         .       g.8143
 ggaggaaggaaggacggaagcaaggaaggaaggaagggctgctggagcccagtcaccccg       c.*120

          .         .         .         .         .         .       g.8203
 ggaccgtgggccgaggtgactgcagaccctcccagggaggctgtgcacagactgtcttga       c.*180

          .         .         .         .         .         .       g.8263
 acatcccaaatgccaccggaaccccagcccttagctcccctcccaggcctctgtgggccc       c.*240

          .         .         .         .                           g.8309
 ttgtcgggcacagatgggatcacagtaaattattggatggtcttga                     c.*286

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The V-Ha-ras Harvey rat sarcoma viral oncogene homolog protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.