heat shock 27kDa protein 1 (HSPB1) - coding DNA reference sequence

(used for variant description)

(last modified January 11, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_001540.3 in the HSPB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008995.1, covering HSPB1 transcript NM_001540.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5035
                          gcatggggaggggcggccctcaaacgggtcattgc       c.-121

 .         .         .         .         .         .                g.5095
 cattaatagagacctcaaacaccgcctgctaaaaatacccgactggaggagcataaaagc       c.-61

 .         .         .         .         .         .                g.5155
 gcagccgagcccagcgccccgcacttttctgagcagacgtccagagcagagtcagccagc       c.-1

          .         .         .         .         .         .       g.5215
 ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGC       c.60
 M  T  E  R  R  V  P  F  S  L  L  R  G  P  S  W  D  P  F  R         p.20

          .         .         .         .         .         .       g.5275
 GACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAG       c.120
 D  W  Y  P  H  S  R  L  F  D  Q  A  F  G  L  P  R  L  P  E         p.40

          .         .         .         .         .         .       g.5335
 GAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC       c.180
 E  W  S  Q  W  L  G  G  S  S  W  P  G  Y  V  R  P  L  P  P         p.60

          .         .         .         .         .         .       g.5395
 GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAA       c.240
 A  A  I  E  S  P  A  V  A  A  P  A  Y  S  R  A  L  S  R  Q         p.80

          .         .         .         .         .         .       g.5455
 CTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGAT       c.300
 L  S  S  G  V  S  E  I  R  H  T  A  D  R  W  R  V  S  L  D         p.100

          .         .         .         .         .         .       g.5515
 GTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC       c.360
 V  N  H  F  A  P  D  E  L  T  V  K  T  K  D  G  V  V  E  I         p.120

      | 02   .         .         .         .         .         .    g.6300
 ACCG | GCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGG    c.420
 T  G |   K  H  E  E  R  Q  D  E  H  G  Y  I  S  R  C  F  T  R      p.140

          | 03         .         .         .         .         .    g.6478
 AAATACAC | GCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAG    c.480
 K  Y  T  |  L  P  P  G  V  D  P  T  Q  V  S  S  S  L  S  P  E      p.160

          .         .         .         .         .         .       g.6538
 GGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC       c.540
 G  T  L  T  V  E  A  P  M  P  K  L  A  T  Q  S  N  E  I  T         p.180

          .         .         .         .         .         .       g.6598
 ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGAT       c.600
 I  P  V  T  F  E  S  R  A  Q  L  G  G  P  E  A  A  K  S  D         p.200

          .                                                         g.6616
 GAGACTGCCGCCAAGTAA                                                 c.618
 E  T  A  A  K  X                                                   p.205

          .         .         .         .         .         .       g.6676
 agccttagcccggatgcccacccctgctgccgccactggctgtgcctcccccgccacctg       c.*60

          .         .         .         .         .         .       g.6736
 tgtgttcttttgatacatttatcttctgtttttctcaaataaagttcaaagcaaccacct       c.*120

                                                                    g.6740
 gtca                                                               c.*124

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Heat shock 27kDa protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.