heat shock 27kDa protein 3 (HSPB3) - coding DNA reference sequence

(used for variant description)

(last modified January 12, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_006308.2 in the HSPB3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_027758.1, covering HSPB3 transcript NM_006308.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5009
                                                    gaaaagaca       c.-181

 .         .         .         .         .         .                g.5069
 agagagcattccgtgctatgattcaggcctaattaagtgattgcgtctgggcacggctat       c.-121

 .         .         .         .         .         .                g.5129
 aaaccactagctgcttcaactggtaatccagtcagtaggcaactgcaggggctcgccact       c.-61

 .         .         .         .         .         .                g.5189
 gactgaaggcagtggaaggttggcagaaggaggctgttcaaggctgtttttgccttcact       c.-1

          .         .         .         .         .         .       g.5249
 ATGGCAAAAATCATTTTGAGGCACCTCATAGAGATTCCAGTGCGTTACCAGGAAGAGTTT       c.60
 M  A  K  I  I  L  R  H  L  I  E  I  P  V  R  Y  Q  E  E  F         p.20

          .         .         .         .         .         .       g.5309
 GAAGCTCGAGGTCTAGAAGACTGCAGGCTGGATCATGCTTTATATGCACTGCCTGGGCCA       c.120
 E  A  R  G  L  E  D  C  R  L  D  H  A  L  Y  A  L  P  G  P         p.40

          .         .         .         .         .         .       g.5369
 ACCATCGTGGACCTGAGGAAAACCAGGGCAGCGCAGTCTCCTCCAGTGGACTCAGCGGCA       c.180
 T  I  V  D  L  R  K  T  R  A  A  Q  S  P  P  V  D  S  A  A         p.60

          .         .         .         .         .         .       g.5429
 GAGACGCCACCCCGAGAAGGCAAATCCCACTTTCAGATCCTGCTGGACGTGGTCCAGTTC       c.240
 E  T  P  P  R  E  G  K  S  H  F  Q  I  L  L  D  V  V  Q  F         p.80

          .         .         .         .         .         .       g.5489
 CTCCCTGAAGACATCATCATTCAGACCTTCGAAGGCTGGCTGCTGATAAAAGCACAACAC       c.300
 L  P  E  D  I  I  I  Q  T  F  E  G  W  L  L  I  K  A  Q  H         p.100

          .         .         .         .         .         .       g.5549
 GGAACCAGAATGGATGAGCACGGTTTTATCTCAAGAAGCTTCACCCGACAGTACAAACTA       c.360
 G  T  R  M  D  E  H  G  F  I  S  R  S  F  T  R  Q  Y  K  L         p.120

          .         .         .         .         .         .       g.5609
 CCAGATGGTGTGGAAATCAAAGATTTGTCTGCAGTCCTCTGTCATGATGGAATTTTGGTG       c.420
 P  D  G  V  E  I  K  D  L  S  A  V  L  C  H  D  G  I  L  V         p.140

          .         .         .                                     g.5642
 GTGGAAGTAAAGGATCCAGTTGGGACTAAGTGA                                  c.453
 V  E  V  K  D  P  V  G  T  K  X                                    p.150

          .         .         .         .         .         .       g.5702
 catcgtatcggttcctgttcagatgacatggggaagatgatggttcagccactggtacta       c.*60

          .         .         .         .         .         .       g.5762
 cgagaatgtttgtattacccacatttgaaatgatttgctatgatttttatgaagattaaa       c.*120

          .         .                                               g.5784
 aatatatacacagttcctggta                                             c.*142

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Heat shock 27kDa protein 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center