heat shock 22kDa protein 8 (HSPB8) - coding DNA reference sequence

(used for variant description)

(last modified January 12, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_014365.2 in the HSPB8 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering HSPB8 transcript NM_014365.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5043
                  ccacagcccagctgttccctccgcggattctccggggctggtt       c.-481

 .         .         .         .         .         .                g.5103
 catcacctccgaatattcctgtgacaggagacgcttgcaaaacccgcctccagcctccag       c.-421

 .         .         .         .         .         .                g.5163
 cagcaaataaatagaaggcttgcagcccagaaggagccagaagaagtttctaggcgcgcg       c.-361

 .         .         .         .         .         .                g.5223
 tgccctgggtttattaagctcctggctccgctctagacctcagcggttctggctgccagc       c.-301

 .         .         .         .         .         .                g.5283
 ctgggcagcctgggaagcctgggaggacggtggcttgccggtctgtcgtgaggcagtgcg       c.-241

 .         .         .         .         .         .                g.5343
 gacggggaccctctgggattctgctggatctgccccgggggttacctttgggggctggga       c.-181

 .         .         .         .         .         .                g.5403
 ccccagtcgaggggacacaaccgtccctggcagtggttggttctgcttctccctgcagaa       c.-121

 .         .         .         .         .         .                g.5463
 aagcagcattttcggaagctgaagaataagctagcccagccacaccaccttgttgtgtga       c.-61

 .         .         .         .         .         .                g.5523
 ccttgggcaggtggttctgtctctctgagcctctgtttctctctgagctgagcagccacc       c.-1

          .         .         .         .         .         .       g.5583
 ATGGCTGACGGTCAGATGCCCTTCTCCTGCCACTACCCAAGCCGCCTGCGCCGAGACCCC       c.60
 M  A  D  G  Q  M  P  F  S  C  H  Y  P  S  R  L  R  R  D  P         p.20

          .         .         .         .         .         .       g.5643
 TTCCGGGACTCTCCCCTCTCCTCTCGCCTGCTGGATGATGGCTTTGGCATGGACCCCTTC       c.120
 F  R  D  S  P  L  S  S  R  L  L  D  D  G  F  G  M  D  P  F         p.40

          .         .         .         .         .         .       g.5703
 CCAGACGACTTGACAGCCTCTTGGCCCGACTGGGCTCTGCCTCGTCTCTCCTCCGCCTGG       c.180
 P  D  D  L  T  A  S  W  P  D  W  A  L  P  R  L  S  S  A  W         p.60

          .         .         .         .         .         .       g.5763
 CCAGGCACCCTAAGGTCGGGCATGGTGCCCCGGGGCCCCACTGCCACCGCCAGGTTTGGG       c.240
 P  G  T  L  R  S  G  M  V  P  R  G  P  T  A  T  A  R  F  G         p.80

          .         .         .         .         .         .       g.5823
 GTGCCTGCCGAGGGCAGGACCCCCCCACCCTTCCCTGGGGAGCCCTGGAAAGTGTGTGTG       c.300
 V  P  A  E  G  R  T  P  P  P  F  P  G  E  P  W  K  V  C  V         p.100

          .         .         .         .         .         .       g.5883
 AATGTGCACAGCTTCAAGCCAGAGGAGTTGATGGTGAAGACCAAAGATGGATACGTGGAG       c.360
 N  V  H  S  F  K  P  E  E  L  M  V  K  T  K  D  G  Y  V  E         p.120

         | 02.         .         .         .         .         .    g.13288
 GTGTCTG | GCAAACATGAAGAGAAACAGCAAGAAGGTGGCATTGTTTCTAAGAACTTCACA    c.420
 V  S  G |   K  H  E  E  K  Q  Q  E  G  G  I  V  S  K  N  F  T      p.140

          .  | 03      .         .         .         .         .    g.19958
 AAGAAAATCCA | GCTTCCTGCAGAGGTGGATCCTGTGACAGTATTTGCCTCACTTTCCCCA    c.480
 K  K  I  Q  |  L  P  A  E  V  D  P  V  T  V  F  A  S  L  S  P      p.160

          .         .         .         .         .         .       g.20018
 GAGGGTCTGCTGATCATCGAAGCTCCCCAGGTCCCTCCTTACTCAACATTTGGAGAGAGC       c.540
 E  G  L  L  I  I  E  A  P  Q  V  P  P  Y  S  T  F  G  E  S         p.180

          .         .         .         .         .                 g.20069
 AGTTTCAACAACGAGCTTCCCCAGGACAGCCAGGAAGTCACCTGTACCTGA                c.591
 S  F  N  N  E  L  P  Q  D  S  Q  E  V  T  C  T  X                  p.196

          .         .         .         .         .         .       g.20129
 gatgccagtactggcccatccttgttttgtccccaaccctagggcttctctgattccagg       c.*60

          .         .         .         .         .         .       g.20189
 atacattactttagctgaactcagatttagtgcaagtaaaatgttagagggtgcgggggt       c.*120

          .         .         .         .         .         .       g.20249
 gaggactgaccacagattccctggatagtgtagtggtagatttctccacaggatagcgca       c.*180

          .         .         .         .         .         .       g.20309
 attggcaaatcatgcttggttgtgttaggccaaaatactagttttgctttctttaccttt       c.*240

          .         .         .         .         .         .       g.20369
 tctatcttgatgaaaatgttgcacattctatagttgcaaaacacataaaaggggacttaa       c.*300

          .         .         .         .         .         .       g.20429
 catttcacgttgtatcttacttgcagtgaatgcaagggttacttttctctggggacctcc       c.*360

          .         .         .         .         .         .       g.20489
 cccatcacccaggttcctactctgggctcccgattcccatggctcccaaaccatgccgca       c.*420

          .         .         .         .         .         .       g.20549
 tggtttggttaatgaaacccagtagctaaccccactgtgcttccacatgcctggcctaaa       c.*480

          .         .         .         .         .         .       g.20609
 atgggtgatatacaggtcttatatccccatatggaatttatccatcaaccacataaaaac       c.*540

          .         .         .         .         .         .       g.20669
 aaacagtgccttctgccctctgcccagatgtgtccagcacgttctcaaagtttccacatt       c.*600

          .         .         .         .         .         .       g.20729
 agcactccctaaggacgctgggagcctgtcagtttatgatctgacctaggtccccccttt       c.*660

          .         .         .         .         .         .       g.20789
 cttctgtcccctgtgtttaagtcgggatttttacagagggagctgtctccagacagctcc       c.*720

          .         .         .         .         .         .       g.20849
 atcaggaaccaagcaaaggccagatagcctgacagataggctagtggtattgtgtatatg       c.*780

          .         .         .         .         .         .       g.20909
 ggcgggacgtgtgtgtcattattatttgagttatgctgttgtttaggggtaaataacagt       c.*840

          .         .         .         .                           g.20957
 aaataattaataataataataataataataaaggagctgacgttctta                   c.*888

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Heat shock 22kDa protein 8 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.