5-hydroxytryptamine (serotonin) receptor 3D, ionotropic (HTR3D) - coding DNA reference sequence

(used for variant description)

(last modified October 26, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_182537.2 in the HTR3D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012750.1, covering HTR3D transcript NM_182537.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .   | 02     .             g.8530
                ctagattcaggcccagttaaagcacagg | tggcttagatcaaaaat    c.-181

 .         .         .         .         .         .                g.8590
 cattattgccacatggaccagccttggaagtgaacaaggagagggtggtggcatgggacc       c.-121

 .         .         .         .         .         .                g.8650
 tgccttcctggagttaatcatctagatgaaagctgctattccaggattcacaccttcaac       c.-61

 .         .         .         | 03         .         .             g.9856
 tggtgacatcgttcctgtggctaaatatg | catcagtgtggatcagacacctgcaggtctc    c.-1

          .         .         .         .         .         .       g.9916
 ATGGCTAGTATGTCAATAGTGAAGGCCACATCAAACACAATAAGCCAATGTGGGTGGTCA       c.60
 M  A  S  M  S  I  V  K  A  T  S  N  T  I  S  Q  C  G  W  S         p.20

          .         .         .         .         .         .       g.9976
 GCATCTGCAAACTGGACACCTTCTATTTCCCCTTCCATGGACAGAGGTGAACGCTCTCCT       c.120
 A  S  A  N  W  T  P  S  I  S  P  S  M  D  R  G  E  R  S  P         p.40

          .         .  | 04      .         .         .         .    g.11516
 TCAGCCCTTTCACCTACACAG | GTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTACGTG    c.180
 S  A  L  S  P  T  Q   | V  A  I  R  R  R  C  R  P  S  P  Y  V      p.60

          .         .         .         .         .         .       g.11576
 GTAAACTTTCTGGTGCCCAGTGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTG       c.240
 V  N  F  L  V  P  S  G  I  L  I  A  I  D  A  L  S  F  Y  L         p.80

          .         .         .         .         .         .       g.11636
 CCACTGGAAAGTGGGAATTGTGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCGTC       c.300
 P  L  E  S  G  N  C  A  P  F  K  M  T  V  L  L  G  Y  S  V         p.100

          .         .         .         .         .         .       g.11696
 TTCCTGCTCATGATGAATGACTTGCTCCCAGCCACTAGCACTTCATCACATGCTTCACTA       c.360
 F  L  L  M  M  N  D  L  L  P  A  T  S  T  S  S  H  A  S  L         p.120

          .         .         .     | 05   .         .         .    g.11891
 GTACGTCCTCATCCATCAAGAGACCAAAAGCGAG | GTGTCTACTTCGCCCTGTGCCTGTCC    c.420
 V  R  P  H  P  S  R  D  Q  K  R  G |   V  Y  F  A  L  C  L  S      p.140

          .         .         .         .         .         .       g.11951
 CTGATGGTGGGCAGCCTGCTGGAGACCATCTTCATCACCCACCTGCTGCACGTGGCCACC       c.480
 L  M  V  G  S  L  L  E  T  I  F  I  T  H  L  L  H  V  A  T         p.160

          .         .         .         .         .         .       g.12011
 ACCCAGCCCCTACCTCTGCCTCGGTGGCTCCACTCCCTGCTGCTGCACTGCACCGGCCAA       c.540
 T  Q  P  L  P  L  P  R  W  L  H  S  L  L  L  H  C  T  G  Q         p.180

          .         .         .         .         .         .       g.12071
 GGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCCGGGTCTCACCCCCACC       c.600
 G  R  C  C  P  T  A  P  Q  K  G  N  K  G  P  G  L  T  P  T         p.200

          . | 06       .         .         .         .         .    g.12252
 CACCTGCCCG | GTGTGAAGGAGCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAG    c.660
 H  L  P  G |   V  K  E  P  E  V  S  A  G  Q  M  P  G  P  G  E      p.220

          .         .         .         .         .         .       g.12312
 GCAGAGCTGACAGGGGGCTCAGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAG       c.720
 A  E  L  T  G  G  S  E  W  T  R  A  Q  R  E  H  E  A  Q  K         p.240

          .         .         .         .         .         .       g.12372
 CAGCACTCGGTGGAGCTGTGGGTGCAGTTCAGCCACGCGATGGACGCCCTGCTCTTCCGC       c.780
 Q  H  S  V  E  L  W  V  Q  F  S  H  A  M  D  A  L  L  F  R         p.260

          .         .         .         .         .         .       g.12432
 CTCTACCTGCTCTTCATGGCCTCCTCCATCATCACCGTCATATGCCTCTGGAACACCTAG       c.840
 L  Y  L  L  F  M  A  S  S  I  I  T  V  I  C  L  W  N  T  X         p.279

          .         .         .         .         .         .       g.12492
 gcaggtgctcacctgcaaacttcagtctggacttctttttgccagagaactccagaaacc       c.*60

          .         .         .         .         .         .       g.12552
 agtcaggctctcagtcagccttgtggccctgtcaaccgcctcatttttaacccagtcctc       c.*120

          .         .         .         .         .         .       g.12612
 tgtgtagtttcagaccagacctgaatagtctcctatgccctccaaaagtcgggtccttgc       c.*180

          .         .         .         .         .         .       g.12672
 tcctgcatgccatcagccccactcagccctcccatacctccctggctcctcaggattcag       c.*240

          .         .         .         .         .         .       g.12732
 gttcctagggtacgtccttgattaaatcaccccaatatgcccctttgcagaaagtattgg       c.*300

          .         .         .         .         .         .       g.12792
 cttttccctgaattctgttatggtaaaaaaaatcttgggattgagagtcttcttgcagaa       c.*360

          .         .         .                                     g.12826
 acttctcagccaaagtaaaaaggattttctctta                                 c.*394

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The 5-hydroxytryptamine (serotonin) receptor 3D, ionotropic protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 25
©2004-2020 Leiden University Medical Center