HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase (HUWE1) - 219 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5225
gtgagcgtctatccctgggctggagggcgagctctgtacgcgcggccgttctcggtttct  c.-262+60

         .         .         .         .         .  g.5275
cgcgggtggcagtggcgaggttggggggggagttcccacgggaccctgcg  c.-262+110

--------------------- middle of intron ---------------------
          g.5276               .         .         .         .           g.5324
          c.-261-109  cggaggcgcggaggtggcggccttggggagcctgcgggaaaggctgctg  c.-261-61

.         .         .         .         .         .           g.5384
gaggggcatggcggcctgccccaaccctccctgaaccccgcctcctctcccctcccccag  c.-261-1


Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center