HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase (HUWE1) - 344 nt intron 50 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.126730
gtagggaatcagagccaatggactggagaggtgggagtagttgctttatgggcctgggat  c.6880+60

         .         .         .         .         .         .  g.126790
cacaactgttctggcttggtggtgtttccctgggaacttgctggccttccagagatctgt  c.6880+120

         .         .         .         .         .    g.126842
catagtggcgtgggaatctgccccacaaagaattccttcaaaatgcagcctt  c.6880+172

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.126894
        gtttggctatcctcacacgtagccttgtcttttcctttgtcacccattcgtt  c.6881-121

.         .         .         .         .         .           g.126954
tattctctgagaacttacaaacttgcccaaggaagggaccttattgtctttgcgcttgcc  c.6881-61

.         .         .         .         .         .           g.127014
tcatggtgcccagcacataggcactctttgattattttgctggttggttgattgtttcag  c.6881-1


Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center