HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase (HUWE1) - 293 nt intron 57 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.132443
gcaagtttgtgtggtgaaagggagggtagaatttgtcagattctactttttccctgctga  c.7915+60

         .         .         .         .         .         .  g.132503
ggaaaagcaagacagtgtctgccctatagaaaacccccattttataggagccagaaccac  c.7915+120

         .         .         g.132530
tcagtgacttagccatgggcaacaaaa  c.7915+147

--------------------- middle of intron ---------------------
                      g.132531          .         .           g.132556
                      c.7916-146  actttattgtctctaggtacttgtta  c.7916-121

.         .         .         .         .         .           g.132616
tgttctaaacattgtgatagaccttgggtccttttagggaaatactgcaatttttggatc  c.7916-61

.         .         .         .         .         .           g.132676
ggtggatcagttaatgcttgacaaggccaagaatctcattcccctttgctgtccctacag  c.7916-1


Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center