HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase (HUWE1) - 161 nt intron 58 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.132826
gtgcgtggcagcttggttatcagggcaatagtgagccttccagagctagggcaaacgtgt  c.8005+60

         .         .   g.132847
ggagagttgtttccctggttc  c.8005+81

--------------------- middle of intron ---------------------
                             g.132848   .         .           g.132867
                             c.8006-80  tctgtggctacaagctctgc  c.8006-61

.         .         .         .         .         .           g.132927
ctcttggcttcctccctgaccccaccagagcagcctttgatttttgcctctttgaaacag  c.8006-1


Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center