HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase (HUWE1) - 266 nt intron 71 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.146768
gtgggtggtagccaccctttggctgggggcttgaatctgggatattctggaagatggctc  c.11048+60

         .         .         .         .         .         .  g.146828
ttgctggtttcctggtcttttttatttctctgggtgattttcgtatctttcctatacaca  c.11048+120

         .     g.146841
cttgacccatttt  c.11048+133

--------------------- middle of intron ---------------------
                                  g.146842        .           g.146854
                                  c.11049-133  tttctacttccta  c.11049-121

.         .         .         .         .         .           g.146914
cttggaagatttccttctgagtttccttacccctctggttgacaccaggaagccttgctt  c.11049-61

.         .         .         .         .         .           g.146974
gctttgggtgtttatactttgatgctgtcaatatacgcaagccacctctacactatccag  c.11049-1


Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center