hydrolethalus syndrome 1 (HYLS1) - coding DNA reference sequence

(used for variant description)

(last modified September 26, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_145014.2 in the HYLS1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering HYLS1 transcript NM_145014.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5054
       aatcctcacattttgggagggaggccaaggcgggcagatcacctgaggttagga       c.-481

 .         .         .         .         .         .                g.5114
 gttcaagatcagcctggccaacatggcgaaaccctgtctctattaaaaataccaaaatta       c.-421

 .         .         .         .         .         .                g.5174
 gctgggcatggtggcacgcgcctgtaataccagctactcaggaggctgaggcaggagagt       c.-361

 .         .         .         .         .         .                g.5234
 cacttgaacccgggaggcggaggctgcagtgagtcgagatcgtgccactgcactccagcc       c.-301

 .         .         .         .         .         .                g.5294
 tgggcgacaagagcgagactctgtctcaaaaaaaaaagagtggttaacaagcatgatgat       c.-241

 .         .         .         .         .         .                g.5354
 acaaccagttgaaagcaatatttgagttcataaagaagttgatgagttgataaaccaaca       c.-181

 .         .         .         .         .          | 02            g.12819
 acacctaattggggaaagcataaggaagagagctgtgttgcaatcaaaag | gttttttttt    c.-121

 .         .         .         .          | 03        .             g.20510
 tacttgaatgtaaataccaatcaagatacattgaaataag | gacctgaaggtggcaagaca    c.-61

 .         .         .         .     | 04   .         .             g.20755
 gtagaaagcaggagtaagagtggaaatgaaagcag | aaggtcctacagtgtaggggaagca    c.-1

          .         .         .         .         .         .       g.20815
 ATGGAAGAACTTCTACCTGATGGACAAATATGGGCTAATATGGATCCAGAAGAACGAATG       c.60
 M  E  E  L  L  P  D  G  Q  I  W  A  N  M  D  P  E  E  R  M         p.20

          .         .         .         .         .         .       g.20875
 TTGGCAGCTGCTACAGCTTTTACCCACATCTGTGCAGGGCAGGGTGAAGGAGATGTCAGG       c.120
 L  A  A  A  T  A  F  T  H  I  C  A  G  Q  G  E  G  D  V  R         p.40

          .         .         .         .         .         .       g.20935
 AGAGAAGCCCAATCTATCCAATATGATCCCTACAGTAAAGCTTCAGTAGCCCCAGGGAAG       c.180
 R  E  A  Q  S  I  Q  Y  D  P  Y  S  K  A  S  V  A  P  G  K         p.60

          .         .         .         .         .         .       g.20995
 CGACCTGCTCTTCCTGTGCAACTACAGTACCCACATGTAGAAAGTAATGTCCCTTCAGAA       c.240
 R  P  A  L  P  V  Q  L  Q  Y  P  H  V  E  S  N  V  P  S  E         p.80

          .         .         .         .         .         .       g.21055
 ACAGTCTCTGAGGCCTCCCAAAGACTCCGAAAGCCAGTGATGAAGAGAAAGGTGCTGCGC       c.300
 T  V  S  E  A  S  Q  R  L  R  K  P  V  M  K  R  K  V  L  R         p.100

          .         .         .         .         .         .       g.21115
 AGAAAGCCAGATGGGGAAGTATTAGTAACAGATGAGTCGATTATCAGTGAATCAGAATCT       c.360
 R  K  P  D  G  E  V  L  V  T  D  E  S  I  I  S  E  S  E  S         p.120

          .         .         .         .         .         .       g.21175
 GGTACAGAAAATGATCAGGATCTCTGGGACTTAAGACAAAGGCTGATGAATGTACAGTTC       c.420
 G  T  E  N  D  Q  D  L  W  D  L  R  Q  R  L  M  N  V  Q  F         p.140

          .         .         .         .         .         .       g.21235
 CAGGAAGACAAGGAATCTTCATTTGATGTTTCACAAAAATTTAACCTACCACATGAATAC       c.480
 Q  E  D  K  E  S  S  F  D  V  S  Q  K  F  N  L  P  H  E  Y         p.160

          .         .         .         .         .         .       g.21295
 CAAGGAATTTCTCAAGATCAGCTCATTTGCTCTCTACAAAGAGAAGGAATGGGCTCTCCA       c.540
 Q  G  I  S  Q  D  Q  L  I  C  S  L  Q  R  E  G  M  G  S  P         p.180

          .         .         .         .         .         .       g.21355
 GCTTACGAACAAGACCTGATTGTTGCCAGCAGACCCAAGTCCTTTATTCTCCCAAAGCTG       c.600
 A  Y  E  Q  D  L  I  V  A  S  R  P  K  S  F  I  L  P  K  L         p.200

          .         .         .         .         .         .       g.21415
 GACCAGTTAAGCCGAAACCGGGGCAAGACAGACCGGGTAGCCCGGTATTTTGAGTACAAA       c.660
 D  Q  L  S  R  N  R  G  K  T  D  R  V  A  R  Y  F  E  Y  K         p.220

          .         .         .         .         .         .       g.21475
 CGGGACTGGGACTCAATACGTTTACCTGGTGAAGATCATAGAAAGGAATTACGCTGGGGT       c.720
 R  D  W  D  S  I  R  L  P  G  E  D  H  R  K  E  L  R  W  G         p.240

          .         .         .         .         .         .       g.21535
 GTCCGAGAGCAGATGCTTTGTCGAGCAGAACCCCAATCCAAACCTCAGCATATATATGTC       c.780
 V  R  E  Q  M  L  C  R  A  E  P  Q  S  K  P  Q  H  I  Y  V         p.260

          .         .         .         .         .         .       g.21595
 CCAAACAATTATCTAGTACCAACAGAGAAGAAAAGGTCTGCACTCCGTTGGGGTGTTCGT       c.840
 P  N  N  Y  L  V  P  T  E  K  K  R  S  A  L  R  W  G  V  R         p.280

          .         .         .         .         .         .       g.21655
 TGTGACCTTGCAAATGGTGTCATACCCAGGAAGCTTCCCTTCCCTCTTTCTCCTTCTTAA       c.900
 C  D  L  A  N  G  V  I  P  R  K  L  P  F  P  L  S  P  S  X         p.299

          .         .         .         .         .         .       g.21715
 atctttttaaacttctttcacaggattgtttgagataacctagctctttatatcttccct       c.*60

          .         .         .         .         .         .       g.21775
 tttaaatagaaacaactgtcttgagaagctcttcgaaacattttatggtaaggacttcac       c.*120

          .         .         .         .         .         .       g.21835
 ctatcattggtctttcctagctatatatcacattggtatcagatgatacttccaaattgc       c.*180

          .         .         .         .         .         .       g.21895
 cactcaaatccagcaattgcaagataaatcatatcagagaaagaacaacagacctggtct       c.*240

          .         .         .         .         .         .       g.21955
 ttctattttgtcaaattagtaagggccctttgtgtcctgtaactttttttacctatcaat       c.*300

          .         .         .         .         .         .       g.22015
 atgagttgctgtgcttcagtgtgtgttttttaagttgctgggcattacacttaccaatta       c.*360

          .                                                         g.22033
 aagaattttggaaattca                                                 c.*378

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Hydrolethalus syndrome 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.