inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4) - 388 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5886
gtgagaggccgggcgccggccgtgggcggacgccgcgggggatgggaggttggtggcgtg  c.441+60

         .         .         .         .         .         .  g.5946
gtggcgggacgcgggcgctcaccgtcctccgggcaggggcgggccaggaatgacagcccc  c.441+120

         .         .         .         .         .         .  g.6006
ctccccctgctcctccgggctcccccgggccgccagcagccggccgggctcggcgagcgc  c.441+180

         .      g.6020
gggtccgggagaac  c.441+194

--------------------- middle of intron ---------------------
                                   g.6021         .           g.6034
                                   c.442-194  gcgcagggcgggac  c.442-181

.         .         .         .         .         .           g.6094
tcggggctgtgggcgccctgggctgtcaagtcccgcctgagcccggaggggcccccccgg  c.442-121

.         .         .         .         .         .           g.6154
ctacaggctggggtgggggcgtcggcgcgccagcctgatttccgaggacaatccaggacc  c.442-61

.         .         .         .         .         .           g.6214
gtgtcgagcgcgttgtttgcgcctgctaacctttcccttggtgttcggttgctgttccag  c.442-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center