interferon induced transmembrane protein 5 (IFITM5) - coding DNA reference sequence

(used for variant description)

(last modified April 22, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_001025295.2 in the IFITM5 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032892.1, covering IFITM5 transcript NM_001025295.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5036
                         accagtctgagtgtggaagagacggcgctggaaccc       c.-1

          .         .         .         .         .         .       g.5096
 ATGGACACGGCGTATCCCCGCGAGGACACCCGGGCCCCCACGCCCAGCAAGGCCGGTGCC       c.60
 M  D  T  A  Y  P  R  E  D  T  R  A  P  T  P  S  K  A  G  A         p.20

          .         .         .         .         .         .       g.5156
 CACACAGCCCTCACACTGGGGGCCCCGCACCCCCCGCCTCGAGACCACTTGATCTGGTCG       c.120
 H  T  A  L  T  L  G  A  P  H  P  P  P  R  D  H  L  I  W  S         p.40

          .         .         .         .         .         .       g.5216
 GTGTTCAGCACCCTCTACCTGAATCTGTGTTGCCTCGGCTTCCTGGCGCTGGCCTACTCC       c.180
 V  F  S  T  L  Y  L  N  L  C  C  L  G  F  L  A  L  A  Y  S         p.60

        | 02 .         .         .         .         .         .    g.5867
 ATCAAG | GCCCGAGATCAGAAGGTGGTTGGTGACCTGGAAGCGGCCCGGCGTTTTGGCTCC    c.240
 I  K   | A  R  D  Q  K  V  V  G  D  L  E  A  A  R  R  F  G  S      p.80

          .         .         .         .         .         .       g.5927
 AAAGCCAAGTGCTACAACATCCTGGCCGCGATGTGGACGCTGGTGCCGCCACTGCTGCTC       c.300
 K  A  K  C  Y  N  I  L  A  A  M  W  T  L  V  P  P  L  L  L         p.100

          .         .         .         .         .         .       g.5987
 CTGGGGCTGGTGGTGACTGGTGCCCTGCACCTGGCCCGGCTGGCCAAGGACTCTGCCGCC       c.360
 L  G  L  V  V  T  G  A  L  H  L  A  R  L  A  K  D  S  A  A         p.120

          .         .         .                                     g.6026
 TTCTTCAGCACCAAGTTTGATGACGCGGACTATGACTGA                            c.399
 F  F  S  T  K  F  D  D  A  D  Y  D  X                              p.132

          .         .         .         .         .         .       g.6086
 caggctgggtcctgatctggggcactagccccaggacactgaccccaggctgctgcccct       c.*60

          .         .         .         .         .         .       g.6146
 ggggcccaatactgactccccggagcctggccctccttctgtggggcctccatccctgcc       c.*120

          .         .         .         .         .         .       g.6206
 ccatcctgatcctggggccctccagccccaacatgggcacctaaggctgaaccagtcaga       c.*180

          .         .         .         .         .         .       g.6266
 ccccggggtcttcaccctaacccgagagttcccgggccctaactctgcccccgatcctgc       c.*240

          .         .         .         .         .         .       g.6326
 ccctccctcctcacactccaggcccctcggttccacgattaaaagtgcctggttccagaa       c.*300

                                                                    g.6327
 a                                                                  c.*301

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Interferon induced transmembrane protein 5 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 23
©2004-2020 Leiden University Medical Center