insulin-like growth factor 1 (somatomedin C) (IGF1) - coding DNA reference sequence

(used for variant description)

(last modified November 22, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_000618.3 in the IGF1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011713.1, covering IGF1 transcript NM_000618.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5039
                      ttttgtagataaatgtgaggattttctctaaatccctct       c.-181

 .         .         .         .         .         .                g.5099
 tctgtttgctaaatctcactgtcactgctaaattcagagcagatagagcctgcgcaatgg       c.-121

 .         .         .         .         .         .                g.5159
 aataaagtcctcaaaattgaaatgtgacattgctctcaacatctcccatctctctggatt       c.-61

 .         .         .         .         .         .                g.5219
 tctttttgcttcattattcctgctaaccaattcattttcagactttgtacttcagaagca       c.-1

          .         .         .         .         .         .       g.5279
 ATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTG       c.60
 M  G  K  I  S  S  L  P  T  Q  L  F  K  C  C  F  C  D  F  L         p.20

     | 02    .         .         .         .         .         .    g.9858
 AAG | GTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTC    c.120
 K   | V  K  M  H  T  M  S  S  S  H  L  F  Y  L  A  L  C  L  L      p.40

          .         .         .         .         .         .       g.9918
 ACCTTCACCAGCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGAT       c.180
 T  F  T  S  S  A  T  A  G  P  E  T  L  C  G  A  E  L  V  D         p.60

          .         .         .         . | 03       .         .    g.65930
 GCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCA | ACAAGCCCACAGGGTATGGC    c.240
 A  L  Q  F  V  C  G  D  R  G  F  Y  F  N |   K  P  T  G  Y  G      p.80

          .         .         .         .         .         .       g.65990
 TCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGT       c.300
 S  S  S  R  R  A  P  Q  T  G  I  V  D  E  C  C  F  R  S  C         p.100

          .         .         .         .         .         .       g.66050
 GATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCT       c.360
 D  L  R  R  L  E  M  Y  C  A  P  L  K  P  A  K  S  A  R  S         p.120

          .         .         .         .   | 04     .         .    g.83052
 GTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAG | GAAGTACATTTGAAGAAC    c.420
 V  R  A  Q  R  H  T  D  M  P  K  T  Q  K   | E  V  H  L  K  N      p.140

          .         .         .         .                           g.83094
 GCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAG                         c.462
 A  S  R  G  S  A  G  N  K  N  Y  R  M  X                           p.153

          .         .         .         .         .         .       g.83154
 gaagaccctcctgaggagtgaagagtgacatgccaccgcaggatcctttgctctgcacga       c.*60

          .         .         .         .         .         .       g.83214
 gttacctgttaaactttggaacacctaccaaaaaataagtttgataacatttaaaagatg       c.*120

          .         .         .         .         .         .       g.83274
 ggcgtttcccccaatgaaatacacaagtaaacattccaacattgtctttaggagtgattt       c.*180

          .         .         .         .         .         .       g.83334
 gcaccttgcaaaaatggtcctggagttggtagattgctgttgatcttttatcaataatgt       c.*240

          .         .         .         .         .         .       g.83394
 tctatagaaaagaaaaaaaaaatatatatatatatatatcttagtccctgcctctcaaga       c.*300

          .         .         .         .         .         .       g.83454
 gccacaaatgcatgggtgttgtatagatccagttgcactaaattcctctctgaatcttgg       c.*360

          .         .         .         .         .         .       g.83514
 ctgctggagccattcattcagcaaccttgtctaagtggtttatgaattgtttccttattt       c.*420

          .         .         .         .         .         .       g.83574
 gcacttctttctacacaactcgggctgtttgttttacagtgtctgataatcttgttagtc       c.*480

          .         .         .         .         .         .       g.83634
 tatacccaccacctcccttcataacctttatatttgccgaatttggcctcctcaaaagca       c.*540

          .         .         .         .         .         .       g.83694
 gcagcaagtcgtcaagaagcacaccaattctaacccacaagattccatctgtggcatttg       c.*600

          .         .         .         .         .         .       g.83754
 taccaaatataagttggatgcattttattttagacacaaagctttatttttccacatcat       c.*660

          .         .         .         .         .         .       g.83814
 gcttacaaaaaagaataatgcaaatagttgcaactttgaggccaatcatttttaggcata       c.*720

          .         .         .         .         .         .       g.83874
 tgttttaaacatagaaagtttcttcaactcaaaagagttccttcaaatgatgagttaatg       c.*780

          .         .         .         .         .         .       g.83934
 tgcaacctaattagtaactttcctctttttattttttccatatagagcactatgtaaatt       c.*840

          .         .         .         .         .         .       g.83994
 tagcatatcaattatacaggatatatcaaacagtatgtaaaactctgttttttagtataa       c.*900

          .         .         .         .         .         .       g.84054
 tggtgctattttgtagtttgttatatgaaagagtctggccaaaacggtaatacgtgaaag       c.*960

          .         .         .         .         .         .       g.84114
 caaaacaataggggaagcctggagccaaagatgacacaaggggaagggtactgaaaacac       c.*1020

          .         .         .         .         .         .       g.84174
 catccatttgggaaagaaggcaaagtccccccagttatgccttccaagaggaacttcaga       c.*1080

          .         .         .         .         .         .       g.84234
 cacaaaagtccactgatgcaaattggactggcgagtccagagaggaaactgtggaatgga       c.*1140

          .         .         .         .         .         .       g.84294
 aaaagcagaaggctaggaattttagcagtcctggtttctttttctcatggaagaaatgaa       c.*1200

          .         .         .         .         .         .       g.84354
 catctgccagctgtgtcatggactcaccactgtgtgaccttgggcaagtcacttcacctc       c.*1260

          .         .         .         .         .         .       g.84414
 tctgtgcctcagtttcctcatctgcaaaatgggggcaatatgtcatctacctacctcaaa       c.*1320

          .         .         .         .         .         .       g.84474
 ggggtggtataaggtttaaaaagataaagattcagattttttttaccctgggttgctgta       c.*1380

          .         .         .         .         .         .       g.84534
 agggtgcaacatcagggcgcttgagttgctgagatgcaaggaattctataaataacccat       c.*1440

          .         .         .         .         .         .       g.84594
 tcatagcatagctagagattggtgaattgaatgctcctgacatctcagttcttgtcagtg       c.*1500

          .         .         .         .         .         .       g.84654
 aagctatccaaataactggccaactagttgttaaaagctaacagctcaatctcttaaaac       c.*1560

          .         .         .         .         .         .       g.84714
 acttttcaaaatatgtgggaagcatttgattttcaatttgattttgaattctgcatttgg       c.*1620

          .         .         .         .         .         .       g.84774
 ttttatgaatacaaagataagtgaaaagagagaaaggaaaagaaaaaggagaaaaacaaa       c.*1680

          .         .         .         .         .         .       g.84834
 gagatttctaccagtgaaaggggaattaattactctttgttagcactcactgactcttct       c.*1740

          .         .         .         .         .         .       g.84894
 atgcagttactacatatctagtaaaacctcgtttaatactataaataatattctattcat       c.*1800

          .         .         .         .         .         .       g.84954
 tttgaaaaacacaatgattccttcttttctaggcaatataaggaaagtgatccaaaattt       c.*1860

          .         .         .         .         .         .       g.85014
 gaaatattaaaataatatctaataaaaagtcacaaagttatcttctttaacaaactttac       c.*1920

          .         .         .         .         .         .       g.85074
 tcttattcttagctgtatatacatttttttaaaagtttgttaaaatatgcttgactagag       c.*1980

          .         .         .         .         .         .       g.85134
 tttccagttgaaaggcaaaaacttccatcacaacaagaaatttcccatgcctgctcagaa       c.*2040

          .         .         .         .         .         .       g.85194
 gggtagcccctagctctctgtgaatgtgttttatccattcaactgaaaattggtatcaag       c.*2100

          .         .         .         .         .         .       g.85254
 aaagtccactggttagtgtactagtccatcatagcctagaaaatgatccctatctgcaga       c.*2160

          .         .         .         .         .         .       g.85314
 tcaagattttctcattagaacaatgaattatccagcattcagatctttctagtcacctta       c.*2220

          .         .         .         .         .         .       g.85374
 gaactttttggttaaaagtacccaggcttgattatttcatgcaaattctatattttacat       c.*2280

          .         .         .         .         .         .       g.85434
 tcttggaaagtctatatgaaaaacaaaaataacatcttcagtttttctcccactgggtca       c.*2340

          .         .         .         .         .         .       g.85494
 cctcaaggatcagaggccaggaaaaaaaaaaaaaagactccctggatctctgaatatatg       c.*2400

          .         .         .         .         .         .       g.85554
 caaaaagaaggccccatttagtggagccagcaatcctgttcagtcaacaagtattttaac       c.*2460

          .         .         .         .         .         .       g.85614
 tctcagtccaacattatttgaattgagcacctcaagcatgcttagcaatgttctaatcac       c.*2520

          .         .         .         .         .         .       g.85674
 tatggacagatgtaaaagaaactatacatcatttttgccctctgcctgttttccagacat       c.*2580

          .         .         .         .         .         .       g.85734
 acaggttctgtggaataagatactggactcctcttcccaagatggcacttctttttattt       c.*2640

          .         .         .         .         .         .       g.85794
 cttgtccccagtgtgtaccttttaaaattattccctctcaacaaaactttataggcagtc       c.*2700

          .         .         .         .         .         .       g.85854
 ttctgcagacttaacgtgttttctgtcatagttagatgtgataattctaagagtgtctat       c.*2760

          .         .         .         .         .         .       g.85914
 gacttatttccttcacttaattctatccacagtcaaaaatcccccaaggaggaaagctga       c.*2820

          .         .         .         .         .         .       g.85974
 aagatgcactgccatattatctttcttaactttttccaacacataatcctctccaactgg       c.*2880

          .         .         .         .         .         .       g.86034
 attataaataaattgaaaataactcattataccaattcactattttattttttaatgaat       c.*2940

          .         .         .         .         .         .       g.86094
 taaaactagaaaacaaattgatgcaaaccctggaagtcagttgattactatatactacag       c.*3000

          .         .         .         .         .         .       g.86154
 cagaatgactcagatttcatagaaaggagcaaccaaaatgtcacaacccaaaactttaca       c.*3060

          .         .         .         .         .         .       g.86214
 agctttgcttcagaattagattgctttataattcttgaatgaggcaatttcaagatattt       c.*3120

          .         .         .         .         .         .       g.86274
 gtaaaagaacagtaaacattggtaagaatgagctttcaactcataggcttatttccaatt       c.*3180

          .         .         .         .         .         .       g.86334
 taattgaccatactggatacttaggtcaaatttctgttctctcttccccaaataatatta       c.*3240

          .         .         .         .         .         .       g.86394
 aagtattatttgaactttttaagatgaggcagttcccctgaaaaagttaatgcagctctc       c.*3300

          .         .         .         .         .         .       g.86454
 catcagaatccactcttctagggatatgaaaatctcttaacacccaccctacatacacag       c.*3360

          .         .         .         .         .         .       g.86514
 acacacacacacacacacacacacacacacacacacacattcaccctaaggatccaatgg       c.*3420

          .         .         .         .         .         .       g.86574
 aatactgaaaagaaatcacttccttgaaaattttattaaaaaacaaacaaacaaacaaaa       c.*3480

          .         .         .         .         .         .       g.86634
 agcctgtccacccttgagaatccttcctctccttggaacgtcaatgtttgtgtagatgaa       c.*3540

          .         .         .         .         .         .       g.86694
 accatctcatgctctgtggctccagggtttctgttactattttatgcacttgggagaagg       c.*3600

          .         .         .         .         .         .       g.86754
 cttagaataaaagatgtagcacattttgctttcccatttattgtttggccagctatgcca       c.*3660

          .         .         .         .         .         .       g.86814
 atgtggtgctattgtttctttaagaaagtacttgactaaaaaaaaaagaaaaaaagaaaa       c.*3720

          .         .         .         .         .         .       g.86874
 aaaagaaagcatagacatatttttttaaagtataaaaacaacaattctatagatagatgg       c.*3780

          .         .         .         .         .         .       g.86934
 cttaataaaatagcattaggtctatctagccaccaccacctttcaactttttatcactca       c.*3840

          .         .         .         .         .         .       g.86994
 caagtagtgtactgttcaccaaattgtgaatttgggggtgcaggggcaggagttggaaat       c.*3900

          .         .         .         .         .         .       g.87054
 tttttaaagttagaaggctccattgttttgttggctctcaaacttagcaaaattagcaat       c.*3960

          .         .         .         .         .         .       g.87114
 atattatccaatcttctgaacttgatcaagagcatggagaataaacgcgggaaaaaagat       c.*4020

          .         .         .         .         .         .       g.87174
 cttataggcaaatagaagaatttaaaagataagtaagttccttattgatttttgtgcact       c.*4080

          .         .         .         .         .         .       g.87234
 ctgctctaaaacagatattcagcaagtggagaaaataagaacaaagagaaaaaatacata       c.*4140

          .         .         .         .         .         .       g.87294
 gatttacctgcaaaaaatagcttctgccaaatcccccttgggtattctttggcatttact       c.*4200

          .         .         .         .         .         .       g.87354
 ggtttatagaagacattctcccttcacccagacatctcaaagagcagtagctctcatgaa       c.*4260

          .         .         .         .         .         .       g.87414
 aagcaatcactgatctcatttgggaaatgttggaaagtatttccttatgagatgggggtt       c.*4320

          .         .         .         .         .         .       g.87474
 atctactgataaagaaagaatttatgagaaattgttgaaagagatggctaacaatctgtg       c.*4380

          .         .         .         .         .         .       g.87534
 aagattttttgtttcttgtttttgttttttttttttttttactttatacagtctttatga       c.*4440

          .         .         .         .         .         .       g.87594
 atttcttaatgttcaaaatgacttggttcttttcttctttttttatatcagaatgaggaa       c.*4500

          .         .         .         .         .         .       g.87654
 taataagttaaacccacatagactctttaaaactataggctagatagaaatgtatgtttg       c.*4560

          .         .         .         .         .         .       g.87714
 acttgttgaagctataatcagactatttaaaatgttttgctatttttaatcttaaaagat       c.*4620

          .         .         .         .         .         .       g.87774
 tgtgctaatttattagagcagaacctgtttggctctcctcagaagaaagaatctttccat       c.*4680

          .         .         .         .         .         .       g.87834
 tcaaatcacatggctttccaccaatattttcaaaagataaatctgatttatgcaatggca       c.*4740

          .         .         .         .         .         .       g.87894
 tcatttattttaaaacagaagaattgtgaaagtttatgcccctcccttgcaaagaccata       c.*4800

          .         .         .         .         .         .       g.87954
 aagtccagatctggtaggggggcaacaacaaaaggaaaatgttgttgattcttggttttg       c.*4860

          .         .         .         .         .         .       g.88014
 gattttgttttgttttcaatgctagtgtttaatcctgtagtacatatttgcttattgcta       c.*4920

          .         .         .         .         .         .       g.88074
 ttttaatattttataagaccttcctgttaggtattagaaagtgatacatagatatctttt       c.*4980

          .         .         .         .         .         .       g.88134
 ttgtgtaatttctatttaaaaaagagagaagactgtcagaagctttaagtgcatatggta       c.*5040

          .         .         .         .         .         .       g.88194
 caggataaagatatcaatttaaataaccaattcctatctggaacaatgcttttgtttttt       c.*5100

          .         .         .         .         .         .       g.88254
 aaagaaacctctcacagataagacagaggcccaggggatttttgaagctgtctttattct       c.*5160

          .         .         .         .         .         .       g.88314
 gcccccatcccaacccagcccttattattttagtatctgcctcagaattttatagagggc       c.*5220

          .         .         .         .         .         .       g.88374
 tgaccaagctgaaactctagaattaaaggaacctcactgaaaacatatatttcacgtgtt       c.*5280

          .         .         .         .         .         .       g.88434
 ccctctttttttttttcctttttgtgagatggggtctcgcactgtcccccaggctggagt       c.*5340

          .         .         .         .         .         .       g.88494
 gcagtggcatgatctcggctcactgcaacctccacctcctgggtttaagcgattctcctg       c.*5400

          .         .         .         .         .         .       g.88554
 cctcagcctcctgagtagctgggattacaggcacccaccactatgcccggctaatttttt       c.*5460

          .         .         .         .         .         .       g.88614
 ggatttttaatagagacggggttttaccatgttggccaggttggtctcaaactcctgacc       c.*5520

          .         .         .         .         .         .       g.88674
 ttgtgatttgcccgcctcagcctcccaaattgctgggattacaggcatgagccaccacac       c.*5580

          .         .         .         .         .         .       g.88734
 cctgcccatgtgttccctcttaatgtatgattacatggatcttaaacatgatccttctct       c.*5640

          .         .         .         .         .         .       g.88794
 cctcattcttcaactatctttgatggggtctttcaaggggaaaaaaatccaagctttttt       c.*5700

          .         .         .         .         .         .       g.88854
 aaagtaaaaaaaaaaaaagagaggacacaaaaccaaatgttactgctcaactgaaatatg       c.*5760

          .         .         .         .         .         .       g.88914
 agttaagatggagacagagtttctcctaataaccggagctgaattacctttcactttcaa       c.*5820

          .         .         .         .         .         .       g.88974
 aaacatgaccttccacaatccttagaatctgcctttttttatattactgaggcctaaaag       c.*5880

          .         .         .         .         .         .       g.89034
 taaacattactcattttattttgcccaaaatgcactgatgtaaagtaggaaaaataaaaa       c.*5940

          .         .         .         .         .         .       g.89094
 cagagctctaaaatccctttcaagccacccattgaccccactcaccaactcatagcaaag       c.*6000

          .         .         .         .         .         .       g.89154
 tcacttctgttaatcccttaatctgattttgtttggatatttatcttgtacccgctgcta       c.*6060

          .         .         .         .         .         .       g.89214
 aacacactgcaggagggactctgaaacctcaagctgtctacttacatcttttatctgtgt       c.*6120

          .         .         .         .         .         .       g.89274
 ctgtgtatcatgaaaatgtctattcaaaatatcaaaacctttcaaatatcacgcagctta       c.*6180

          .         .         .         .         .         .       g.89334
 tattcagtttacataaaggccccaaataccatgtcagatctttttggtaaaagagttaat       c.*6240

          .         .         .         .         .         .       g.89394
 gaactatgagaattgggattacatcatgtattttgcctcatgtatttttatcacacttat       c.*6300

          .         .         .         .         .         .       g.89454
 aggccaagtgtgataaataaacttacagacactgaattaatttcccctgctactttgaaa       c.*6360

          .         .         .         .         .         .       g.89514
 ccagaaaataatgactggccattcgttacatctgtcttagttgaaaagcatattttttat       c.*6420

          .         .         .         .         .         .       g.89574
 taaattaattctgattgtatttgaaattattattcaattcacttatggcagaggaatatc       c.*6480

          .         .         .         .         .         .       g.89634
 aatcctaatgacttctaaaaatgtaactaattgaatcattatcttacatttactgtttaa       c.*6540

          .         .         .         .         .         .       g.89694
 taagcatattttgaaaatgtatggctagagtgtcataataaaatggtatatctttcttta       c.*6600

          .         .         .         .                           g.89734
 gtaattacattaaaattagtcatgtttgattaattagttc                           c.*6640

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Insulin-like growth factor 1 (somatomedin C) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center