insulin-like growth factor 1 (somatomedin C) (IGF1) - downstream reference sequence


         .            .         .         .         .         . g.89780
tgattaattagttc / ttttggataatgttggtgtaatgtgtcattccttaagaattctact c.*6720

         .         .         .         .         .         .    g.89840
gttatataccatttttattaaggtcattgcaataaataaacatgaaaacatacccagaaa    c.*6780

         .         .         .         .         .         .    g.89900
aacaaaactaatcacacacaaaaatgaagacatctcatagaatttacagattctatttaa    c.*6840

         .         .         .         .         .         .    g.89960
aagtaaatatgtttcaaaggacttgcaaaagctatgtaagagatgtatgaattgtacaat    c.*6900

         .         .         .         .         .         .    g.90020
atatgcattaacaataaagcagttgtacgtaaaatcccctcactgtcacccaacagtgac    c.*6960

         .         .         .         .         .         .    g.90080
ttataatccctgacacaaagtggttgggaaaatattctattgccagaaggttcacacgta    c.*7020

         .         .         .         .         .         .    g.90140
tcaaataaggcacataatatataaatggcatctaatacattcccataccaagagatttat    c.*7080

         .         .         .         .         .         .    g.90200
aagaatgtgatctctcagcattgagtttttgtttcaataaatcgttccaattttttactg    c.*7140

         .         .         .         .         .         .    g.90260
aatagatactgtgaatatcaaattcacaacagcatttatagaagtacaaggtataaagat    c.*7200

         .         .         .         .         .         .    g.90320
tggtaatctccctcgtttaaaagcatctcatttcattttttaaaaattcattaactattt    c.*7260

         .         .         .         .         .         .    g.90380
ggaaagttacccaaatataaaaaaagtctcacaagttttgtacttagttttaaggaaatt    c.*7320

         .         .         .         .         .         .    g.90440
atagtaaagttttctttaatattttctcacgtgccattggtgtcccatctcacgttcatt    c.*7380

         .         .         .         .         .         .    g.90500
cctacctttgctccctcaaaatgtccaagaatctccctgggactaacattatgcgggccc    c.*7440

         .         .         .         .         .         .    g.90560
cttcttcctccaaatgtcttgttcatgctcttagcattttgcctcctatagtcatggtgt    c.*7500

         .         .         .         .         .         .    g.90620
tctgtactacttctcccctcgctccactccagacaatccctctctcctttcattcacact    c.*7560

         .         .         .         .         .         .    g.90680
agggtgatctagccacagcctttcactaaagattttgtaaacaatgaaaaggggatgagt    c.*7620

         .         .         .         .         .         .    g.90740
taagcacaggacagaaaataccttccatttcaatggcaaacatcactattactatgaatc    c.*7680

         .         .         .         .         .         .    g.90800
caaggaatttctggtggctcatgtgcctcctgtcatcttagcaagatcttttccactctt    c.*7740

         .         .         .         .         .         .    g.90860
ctgcaaactctcccaggaaccactttctatcaaaccctttatcccctcctttggaaagaa    c.*7800

         .         .         .         .         .         .    g.90920
cttataagaaaattatattgtattcttatgcagggcaatctttccccatcccagctttgc    c.*7860

         .         .         .         .         .         .    g.90980
cagtggtgggggtgggggcagggctggctcaccttttgttactgaatatgtacaaaaggt    c.*7920

         .         .         .         .         .         .    g.91040
gttctttcctaaaggaaataccaattctatccctaagaggaattctatcttccttccagg    c.*7980

         .         .         .         .         .         .    g.91100
tcatctacgtcaaataacagcctctttttttaaaagaacatctttttcttctgtaagatc    c.*8040

         .         .         .         .         .         .    g.91160
tttattggagataattaccaccactccaacaataagggtggttaatatttactgagcact    c.*8100

         .         .         .         .         .         .    g.91220
tactgtgagtcagtcattatgccaagtggtttacctatattatctcattcatccttccaa    c.*8160

         .         .         .         .         .         .    g.91280
caagcctatgcatcaggcactattgtaaacactgactgataaggaaatggaggctcaaag    c.*8220

         .         .         .         .         .         .    g.91340
acattacttagtttactgaaggtcacagaccagcagagaaggcttgaatctgggtctgag    c.*8280

         .         .         .         .         .         .    g.91400
gacatcaaatctgggtctgaagacacttgcttttactactccaccacttacacccaatcc    c.*8340

         .         .         .         .         .         .    g.91460
aggcatgaggacagctcagaatactgactgatactttcttgttcaaaattggctttacac    c.*8400

         .         .         .         .         .         .    g.91520
gctacaggcagacacatggctaatggcacctttgagtgatgacctattattgagtatgat    c.*8460

         .         .         .         .         .         .    g.91580
attatcaggataaagaagcatttctgcacggtaaccaatgtatctaataatgtgtcattc    c.*8520

         .         .         .         .         .         .    g.91640
cccactgccgttcttccacatgtgcatgtcagttctggatagtacttcatgctatgcagg    c.*8580

         .         .         .         .         .         .    g.91700
taacacccagggatatagagccaatctcgggatacctccatgaagaaagttatgtattgg    c.*8640

         .         .         .                                  g.91735
ctcttacacagtctaggaataaaccattcccacct                             c.*8675


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center