insulin-like growth factor 1 (somatomedin C) (IGF1) - 1505 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.66152
gtaagcccacctgggtgggatccagccatcctcaagtggtctctctcttgtgcatgtggg  c.402+60

         .         .         .         .         .         .  g.66212
tgggccaagcagaaatcctgccccatagtctcctggcttacaagtcagaaaagctccttt  c.402+120

         .         .         .         .         .         .  g.66272
gcaccaaagggatggattacatccccatctctttggtcactctgcattgcaaatttcccc  c.402+180

         .         .         .         .         .         .  g.66332
tcccaccgctatggacgatgtgatgattggaagatgttacaaaacagtggctaaacaaac  c.402+240

         .         .         .         .         .         .  g.66392
atgggctttggtgtcagacaaaagtgaagtcctggctttctcacacaccagcttagagcc  c.402+300

         .         .         .         .         .         .  g.66452
cttggcaaataatgtgatgtacccaagcctcagtttcatcagtaacattgggataataat  c.402+360

         .         .         .         .         .         .  g.66512
aatatctaccacatcagtttgttgtcaaaattaagtagctcatgcatatactttgagatg  c.402+420

         .         .         .         .         .         .  g.66572
cttttcacatgcctgcataaagtaattgttggaccatcgttaatgtctgccataattgca  c.402+480

         .         .         .         .         .         .  g.66632
cttaataacaaagcttgtaacctttcaagttctgagattctacaatcttccaaagaaaat  c.402+540

         .         .         .         .         .         .  g.66692
aaaaggctaatgggaactattcaaaattcatattcagtagcaagcataattaaacatgaa  c.402+600

         .         .         .         .         .         .  g.66752
acattaaaaatagaaatttctgtttggctataagaatgcctagacatttgtaatgatcaa  c.402+660

         .         .         .         .         .         .  g.66812
aatctgcaggcatcattttctaagagctagactgtaaacaaacctcagaggtaccaacta  c.402+720

         .         .         .     g.66845
tgccatcagtagtacataaaacatctgatgcac  c.402+753

--------------------- middle of intron ---------------------
                 g.66846      .         .         .           g.66877
                 c.403-752  atttagtcacttgatcgatttctcttgaatga  c.403-721

.         .         .         .         .         .           g.66937
gtgaacgaatgaacaaatgaatataagagattaaaattttagccattaagtagaaagaat  c.403-661

.         .         .         .         .         .           g.66997
aagaactaaagagaaggtaaaggaggaaaaagagaaggcaaggaagttgagtaagggaag  c.403-601

.         .         .         .         .         .           g.67057
aaatagctctcgtttaagtattttggggactctgttgaaaaaagaaatgccaacatgtgg  c.403-541

.         .         .         .         .         .           g.67117
ttttaatctttggagctagaactaataatattgtgcaaaagcacaagatgagagatcaag  c.403-481

.         .         .         .         .         .           g.67177
aagttcaccatgacaccttcgctgcttcctggtcttaaacctcagctgaggctggaagag  c.403-421

.         .         .         .         .         .           g.67237
gaccatggtggcttattggagatgtgaccccagggagcccctctgaaggatggaagggga  c.403-361

.         .         .         .         .         .           g.67297
ctgggcaagacccaacacacacagaacacagtagccactggccaggcaggaagcaaggat  c.403-301

.         .         .         .         .         .           g.67357
ctcagaaaagacttttaggtgaatgtggcaggaaagcgtgcttgctggggcaaaggcaga  c.403-241

.         .         .         .         .         .           g.67417
ttcattctttctcttcccaggtgacccagcgcctcttggtttctaactggggagggggta  c.403-181

.         .         .         .         .         .           g.67477
ggtgtcaagagatgagtcccaaagttctggaatggtgggtcttgtgactgaggtctagac  c.403-121

.         .         .         .         .         .           g.67537
ccctctccagcatgagtgctgtctcctgcatcatatggagcctgggcattctgagctcat  c.403-61

.         .         .         .         .         .           g.67597
tcaaagggacaccatgggaaccacttgttctcaatgcaattatttttgtgatgtttacag  c.403-1


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center