insulin-like growth factor 1 (somatomedin C) (IGF1) - upstream reference sequence


          .         .         .         .         .             g.59
 aggaacttctgtctggaaagattttggacttgagattcactttttggttgttaaaacga    c.-5161

.         .         .         .         .         .             g.119
gaggtttttgcaacacaaaggataaatgtttgaggggatggatacccaattctccatgat    c.-5101

.         .         .         .         .         .             g.179
gtgtttatttcacatttcatgcctgtatcaaaatatctcacgtgtcccataaatatatat    c.-5041

.         .         .         .         .         .             g.239
acctactacatacccacaaaaattaaaaattaaattaaaaaataaaataaagagagacta    c.-4981

.         .         .         .         .         .             g.299
atgagtgctagggaagcactgaagacagactagcgccaaactgagactttctcctttgga    c.-4921

.         .         .         .         .         .             g.359
gattcaggatcagaaagggaattgtaaatggaatcatctctatacttaagtgattcttta    c.-4861

.         .         .         .         .         .             g.419
acgccacgtctttgaccaggggtgttataacccacattttgaaaactaacatgatagaaa    c.-4801

.         .         .         .         .         .             g.479
tactgcagaacagacaaggagactgggtttgaattctattttgtgagcacctaaatttgt    c.-4741

.         .         .         .         .         .             g.539
cttgcttctcgagaagtcatttttctatcctccaacagcccctcttcctggtcttatttt    c.-4681

.         .         .         .         .         .             g.599
tcttataaaatgaggaggttggttattttactcttaaagagtttgtgcaatttttatatt    c.-4621

.         .         .         .         .         .             g.659
ttacctttatcatcatttgttttccagacttgcattcattcaacaaaatgttttgagctc    c.-4561

.         .         .         .         .         .             g.719
atgcacccggagttaagtgctgggaatatggccatgaggaatccatccatgccctgatga    c.-4501

.         .         .         .         .         .             g.779
agtttatgatctttctttcccccttatcaatcttcccctttttaaactacagtgagttga    c.-4441

.         .         .         .         .         .             g.839
acatctatcttacttatttcaaaagacttaataaaactaaagataagtgtagcttaaaat    c.-4381

.         .         .         .         .         .             g.899
gtatttaaatccagagctttcaaaaaaaaaacccactcctgccagaacgcatccacggtc    c.-4321

.         .         .         .         .         .             g.959
aagagtgcagtggcagtttctcagaagtccactagagggcgcgcacatttttttattccc    c.-4261

.         .         .         .         .         .             g.1019
caagaaagcatttatgtgggtcctgcccctgaagtttggcgttggtgtctcttttcccca    c.-4201

.         .         .         .         .         .             g.1079
cattttatgcaacgtggggcaagcgtgacgagtcctcaagttctctcactccaccaaccc    c.-4141

.         .         .         .         .         .             g.1139
atccttaccccatgccgtgacttctcctctgccataacgaagaattactttgctcacaca    c.-4081

.         .         .         .         .         .             g.1199
accacaacagtttcgtttctgtttccagtatttgcccttttgacattttagaagaaataa    c.-4021

.         .         .         .         .         .             g.1259
gatccaagtttgatgttgaaaagaaagcattgatttctttagtgagaggatttctcctcc    c.-3961

.         .         .         .         .         .             g.1319
ctatttctgttttccctagtcgtgggcgaaacacttctttaaggagttagagcagctcct    c.-3901

.         .         .         .         .         .             g.1379
ttgagcaaatcttcctggggaatcacaggaatctttctgagcagatgttttggagctgac    c.-3841

.         .         .         .         .         .             g.1439
attaggccccttgctcggcagcatgttgagtttttgaggccctgtctttcctctgagttt    c.-3781

.         .         .         .         .         .             g.1499
tatattctgaattgacaagttcttgacctccaacattagtttgagcaacccatgaccaac    c.-3721

.         .         .         .         .         .             g.1559
cctcctcacaaaccatgatccaaaagaaacatccaatagtttcccccaagttctttgcct    c.-3661

.         .         .         .         .         .             g.1619
ggtggttgccctagaaccttaagcctcaccctttatttgattccaaaattcccttacctc    c.-3601

.         .         .         .         .         .             g.1679
caaatgtccattctgagctttccttgggagtaagcaaagacattcatgaaataaattgta    c.-3541

.         .         .         .         .         .             g.1739
aatatgccctattgtacatggatatgaaattaccttttggatgaacgcctctccagttaa    c.-3481

.         .         .         .         .         .             g.1799
cacaggaaagactgggaacatggcttgagaagaaaaaaaaagttggggggaagacaggga    c.-3421

.         .         .         .         .         .             g.1859
gggcctccttgcccaccccacccctgctttctgtgtaccttagccagctcaccctttaag    c.-3361

.         .         .         .         .         .             g.1919
gaaatgaacaattttttctgtgtgtgtgcgaaaggtgtcagaagttttctgaggctgtag    c.-3301

.         .         .         .         .         .             g.1979
ctttatgcaaatatgctactcaagaagaaggctttaggggagagttatttatatcccaca    c.-3241

.         .         .         .         .         .             g.2039
ggcattacacatgcaaaaggtgaaactgtgaatctctgaatttccaggagtggatgttct    c.-3181

.         .         .         .         .         .             g.2099
tatgataagcacatccttgcggttagctattttggtggccatatctcactgtcagatttt    c.-3121

.         .         .         .         .         .             g.2159
tgcaggcaggagactacataatcattccatacttttataatgaccctagatgtttctctc    c.-3061

.         .         .         .         .         .             g.2219
caatgggacttcataacctgaactcctcttgggctttagatttactactaccttggattt    c.-3001

.         .         .         .         .         .             g.2279
gtagtaataggtgcattcatttcttttactcctaaacaggtacatcacttagccattaaa    c.-2941

.         .         .         .         .         .             g.2339
aagtaatctggtggcatgtttattgctctttcattttcatattgactcctggaattagcc    c.-2881

.         .         .         .         .         .             g.2399
aagaaaatgaccttttctctaggaattattgccctgatccattgctggctcaccctgtcc    c.-2821

.         .         .         .         .         .             g.2459
aaaaatatagaccattctccaaattgaaatatacattaatcacctcaggaaattgcttcc    c.-2761

.         .         .         .         .         .             g.2519
cccattggaaactgatagctctcattggaatgtttccaaagcacagctgatgacaattac    c.-2701

.         .         .         .         .         .             g.2579
gactcactgaaatttcagttttctttgattgtgacataaaaactaggacataaattaaaa    c.-2641

.         .         .         .         .         .             g.2639
cctaattatcctttaagggtaattggggttacaaaaccgagagactgtgagtcagtgtgt    c.-2581

.         .         .         .         .         .             g.2699
caatatcgctggagtacagcatctgtccccaaaacagcctttcatatgaaatgcttgtgg    c.-2521

.         .         .         .         .         .             g.2759
ataaggttatatctgtgcaccgagcatgccaagagagaacatcaaaatgggtgatagact    c.-2461

.         .         .         .         .         .             g.2819
tggagacatatagttagcttctaggacatcttggaacaattaaagtatgctaaaactgca    c.-2401

.         .         .         .         .         .             g.2879
gtgggaaggggttaaacaaagtcctggccttcacctgtaatggtgtccaatgttggaaca    c.-2341

.         .         .         .         .         .             g.2939
agaacttagcaccaagactccagccagtatctgactctccaaacttggttaaagaggttt    c.-2281

.         .         .         .         .         .             g.2999
tttctcatctggaagacaggtgagatcagctctattgttttatacaatctacatcctcaa    c.-2221

.         .         .         .         .         .             g.3059
agtctgtaagagaatagacatttttcagaaagggtgtgatccacaaaaactgcagaaaag    c.-2161

.         .         .         .         .         .             g.3119
aaaaagatttgtcacaaatcaagtgtacaaagagagcttattaaaggaagccacggatta    c.-2101

.         .         .         .         .         .             g.3179
ttattaaatgcagggattactcacacatctgcacatgtggataatccctgcattaagaat    c.-2041

.         .         .         .         .         .             g.3239
aatccagggccacctactaggccacctcttgatgatacctcttagtgtgctctttgggtc    c.-1981

.         .         .         .         .         .             g.3299
aaatcccacccactgaaatttcccaacatggtaccccaaagcctctcatgacacaatctg    c.-1921

.         .         .         .         .         .             g.3359
cctccctcattttggattttccaaaagattttactcccctgtcttcccagagaatgtgtc    c.-1861

.         .         .         .         .         .             g.3419
actccctctcattgtgcactgttcatgtttttaaaagagcacatgcccatcatatgactg    c.-1801

.         .         .         .         .         .             g.3479
tgaagttttcctctttgtctctgacattcagctgaaagcccctgaagggacttgaccata    c.-1741

.         .         .         .         .         .             g.3539
tcttattcctctttgttttcctagggatgttgtagttgggcacatagtagagctcacaaa    c.-1681

.         .         .         .         .         .             g.3599
atgttgctgaacatagtgcaccattgacacaacataattccagatttctaactttgattt    c.-1621

.         .         .         .         .         .             g.3659
ctgaaaggtaaacattgctacaatgtattaaccacacagaagactcaaacaaacccaacc    c.-1561

.         .         .         .         .         .             g.3719
cccttccaaacaaagcaggtttgtttgttttttgttagggcacccacttctacaaacaaa    c.-1501

.         .         .         .         .         .             g.3779
tttctggccccaggataacacaaagagccagagtaggatttcaagcagaactgtgttttc    c.-1441

.         .         .         .         .         .             g.3839
agttgatgtgtcagtcccctgagagtcatgtggaaaaaaaaaaaaagaaaaaattcaagg    c.-1381

.         .         .         .         .         .             g.3899
tccaggttatttccaccactcctgggaaaccaggcctggagagctctctagggaaagagg    c.-1321

.         .         .         .         .         .             g.3959
tatgtctgctctgggcttttgcaaccttattttataattcactttcttatctactgcttc    c.-1261

.         .         .         .         .         .             g.4019
acaaaaccaaagggaaataggtacaaactgtatcgacaaaagatcagaactgaattctca    c.-1201

.         .         .         .         .         .             g.4079
atggcaaaggcaagtgtacattataaatagcaaaacagctggcttggaccatgttgccgg    c.-1141

.         .         .         .         .         .             g.4139
ccagtcacccagttgagggatttgaatgacatcataaccctcgagagggtattgctagcc    c.-1081

.         .         .         .         .         .             g.4199
agctggtgttatttagaatacacaaaaatcagagaaagaaaacacactctggcacacaga    c.-1021

.         .         .         .         .         .             g.4259
ctccctctgtcatacacacacacacacacacacacacacacacacacacacacaggtttg    c.-961

.         .         .         .         .         .             g.4319
agttatatggaaaattcaaacaacaggaaaattgtttgccccccaggtacccttctccca    c.-901

.         .         .         .         .         .             g.4379
gagtggtggggtggggaggggacagtgacaggcagcctagtagaagaataaagaaaaatg    c.-841

.         .         .         .         .         .             g.4439
ttctatttcagttgggttttacagctcggcatagtctttgcctcatcgcaggagaaaaag    c.-781

.         .         .         .         .         .             g.4499
tatgagacagtgccctaaagggaccaatccaatgctgcctgcccctccataggttctagg    c.-721

.         .         .         .         .         .             g.4559
aaatgagatcacacctctcacttggcaactgggacaaggggtcacccgagtgctgtcttc    c.-661

.         .         .         .         .         .             g.4619
caatctactttaccccagtcacttcagggttaaaattgtagagtttgctggagagggtct    c.-601

.         .         .         .         .         .             g.4679
tatcgtcctttctttctttttttgttttaaataatgcatttgctctagaatctaaaattg    c.-541

.         .         .         .         .         .             g.4739
ctctcccatcccccatattcctttaatactggtaaggtgtattagcagacgtttgtgtct    c.-481

.         .         .         .         .         .             g.4799
tcatgcccagcagaaagttaatcagaaaacagatccttattttctatggcagcataagta    c.-421

.         .         .         .         .         .             g.4859
ttttaatgtctgcgaaccctgtcactaacacacattcttttaagggaaaaaaatgcttct    c.-361

.         .         .         .         .         .             g.4919
gtgctctagttttaaaatgcaaaggtatgatgttatttgtcaccatgcccaaaaaagtcc    c.-301

.         .         .         .         .         .             g.4979
ttactcaataactttgccagaagagggagagagagagaaggcaaatgttcccccagctgt    c.-241

.         .         .            .         .         .          g.5039
ttcctgtctacagtgtctgtg \ ttttgtagataaatgtgaggattttctctaaatccctct c.-181


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center