immunoglobulin superfamily, member 1 (IGSF1) - coding DNA reference sequence

(used for variant description)

(last modified October 24, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_001170961.1 in the IGSF1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_021190.2, covering IGSF1 transcript NM_001170961.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.115317
                  aggtgccaggcagagttggtgtaggtgggctccccgagcccgg       c.-241

 .         .         .         .         .         .                g.115377
 cgcagggaggggaggaggttggggcgggccggcaggcgggcgggggagagaggaaggcgg       c.-181

 .         .         .         .         .         .                g.115437
 ggctcagagccgaagaggctgtccttagacagctcttctcatgccgggcagtttgctgca       c.-121

 .         .         .         .         .         .   | 02         g.117969
 tctggaggagctcactggagaatctccaacatcggagcgggccttcaactacc | atcccac    c.-61

 .         .         .         .         .         .                g.118029
 cacctgctgaggagaaaaattcttcaagactcagagcacacagccagcaccagaggcccc       c.-1

          .         .         .         .         .         .       g.118089
 ATGACCCTGGACAGACCAGGGGAGGGGGCCACCATGCTGAAGACATTCACTGTTTTGCTC       c.60
 M  T  L  D  R  P  G  E  G  A  T  M  L  K  T  F  T  V  L  L         p.20

          . | 03       .         .        | 04.         .         . g.118678
 TTTTGCATTC | GGATGAGTCTGGGTATGACATCGATAG | TGATGGACCCTCAACCGGAGTTG c.120
 F  C  I  R |   M  S  L  G  M  T  S  I  V |   M  D  P  Q  P  E  L   p.40

          .         .         .         .         .         .       g.118738
 TGGATAGAGTCCAACTACCCCCAGGCCCCTTGGGAGAACATCACGCTTTGGTGCCGAAGC       c.180
 W  I  E  S  N  Y  P  Q  A  P  W  E  N  I  T  L  W  C  R  S         p.60

          .         .         .         .         .         .       g.118798
 CCCTCTCGGATATCAAGCAAGTTCCTGCTGCTGAAGGATAAGACACAGATGACCTGGATC       c.240
 P  S  R  I  S  S  K  F  L  L  L  K  D  K  T  Q  M  T  W  I         p.80

          .         .         .         .         .         .       g.118858
 CGCCCTTCCCACAAGACCTTCCAAGTTTCATTCCTTATAGGTGCCCTTACTGAGTCCAAT       c.300
 R  P  S  H  K  T  F  Q  V  S  F  L  I  G  A  L  T  E  S  N         p.100

          .         .         .         .         .         .       g.118918
 GCAGGTCTTTACCGGTGCTGCTACTGGAAGGAGACAGGCTGGTCAAAGCCCAGTAAAGTT       c.360
 A  G  L  Y  R  C  C  Y  W  K  E  T  G  W  S  K  P  S  K  V         p.120

          .          | 05        .         .         .         .    g.119278
 CTAGAGTTGGAGGCACCAG | GCCAACTGCCCAAGCCCATCTTCTGGATTCAGGCTGAGACC    c.420
 L  E  L  E  A  P  G |   Q  L  P  K  P  I  F  W  I  Q  A  E  T      p.140

          .         .         .         .         .         .       g.119338
 CCCGCTCTTCCTGGGTGTAATGTTAACATCCTCTGCCATGGCTGGCTGCAGGATTTGGTA       c.480
 P  A  L  P  G  C  N  V  N  I  L  C  H  G  W  L  Q  D  L  V         p.160

          .         .         .         .         .         .       g.119398
 TTCATGCTGTTTAAAGAGGGATATGCAGAGCCTGTGGATTACCAAGTCCCAACTGGGACA       c.540
 F  M  L  F  K  E  G  Y  A  E  P  V  D  Y  Q  V  P  T  G  T         p.180

          .         .         .         .         .         .       g.119458
 ATGGCCATATTCTCCATTGACAACCTGACACCTGAGGATGAAGGGGTTTACATCTGCCGC       c.600
 M  A  I  F  S  I  D  N  L  T  P  E  D  E  G  V  Y  I  C  R         p.200

          .         .         .         .         .         .       g.119518
 ACTCATATCCAGATGCTCCCCACCCTGTGGTCAGAGCCCAGCAACCCCCTGAAGCTGGTT       c.660
 T  H  I  Q  M  L  P  T  L  W  S  E  P  S  N  P  L  K  L  V         p.220

         | 06.         .         .         .         .         .    g.121492
 GTAGCAG | GACTCTACCCCAAACCAACTTTGACAGCCCATCCTGGGCCCATCATGGCACCT    c.720
 V  A  G |   L  Y  P  K  P  T  L  T  A  H  P  G  P  I  M  A  P      p.240

          .         .         .         .         .         .       g.121552
 GGAGAAAGCCTGAATCTCAGGTGCCAAGGGCCAATCTATGGAATGACCTTTGCTCTAATG       c.780
 G  E  S  L  N  L  R  C  Q  G  P  I  Y  G  M  T  F  A  L  M         p.260

          .         .         .         .         .         .       g.121612
 AGGGTTGAAGACTTGGAGAAGTCCTTTTACCACAAGAAGACAATAAAAAATGAGGCAAAT       c.840
 R  V  E  D  L  E  K  S  F  Y  H  K  K  T  I  K  N  E  A  N         p.280

          .         .         .         .         .         .       g.121672
 TTCTTCTTCCAGTCTTTGAAGATCCAAGATACTGGACATTACCTCTGTTTTTACTATGAC       c.900
 F  F  F  Q  S  L  K  I  Q  D  T  G  H  Y  L  C  F  Y  Y  D         p.300

          .         .         .         .         .   | 07     .    g.121974
 GCATCATATAGAGGTTCACTCCTTAGTGATGTCCTGAAAATCTGGGTGACTG | ACACTTTC    c.960
 A  S  Y  R  G  S  L  L  S  D  V  L  K  I  W  V  T  D |   T  F      p.320

          .         .         .         .         .         .       g.122034
 CCCAAGACCTGGCTACTTGCTCGGCCCAGTGCTGTGGTCCAAATGGGTCAGAATGTGAGC       c.1020
 P  K  T  W  L  L  A  R  P  S  A  V  V  Q  M  G  Q  N  V  S         p.340

          .         .         .         .         .         .       g.122094
 CTACGGTGTCGAGGACCAGTGGATGGAGTGGGTCTTGCACTCTATAAGAAAGGAGAAGAC       c.1080
 L  R  C  R  G  P  V  D  G  V  G  L  A  L  Y  K  K  G  E  D         p.360

          .         .         .         .         .         .       g.122154
 AAACCACTTCAATTTTTGGATGCCACCAGCATCGATGACAACACATCATTCTTCCTCAAC       c.1140
 K  P  L  Q  F  L  D  A  T  S  I  D  D  N  T  S  F  F  L  N         p.380

          .         .         .         .         .         .       g.122214
 AATGTAACCTACAGTGATACTGGCATCTATAGCTGCCACTATCTTCTCACCTGGAAGACC       c.1200
 N  V  T  Y  S  D  T  G  I  Y  S  C  H  Y  L  L  T  W  K  T         p.400

          .         .         .         .       | 08 .         .    g.122773
 TCCATTAGGATGCCATCACACAACACTGTGGAGCTTATGGTTGTAG | ATAAGCCCCCCAAA    c.1260
 S  I  R  M  P  S  H  N  T  V  E  L  M  V  V  D |   K  P  P  K      p.420

          .         .         .         .         .         .       g.122833
 CCCTCCCTGTCAGCTTGGCCAAGCACTGTGTTCAAGCTAGGAAAGGCCATCACCCTTCAG       c.1320
 P  S  L  S  A  W  P  S  T  V  F  K  L  G  K  A  I  T  L  Q         p.440

          .         .         .         .         .         .       g.122893
 TGCCGAGTATCTCATCCAGTACTGGAATTTTCTCTGGAATGGGAAGAAAGAGAAACATTC       c.1380
 C  R  V  S  H  P  V  L  E  F  S  L  E  W  E  E  R  E  T  F         p.460

          .         .         .         .         .         .       g.122953
 CAAAAATTCTCAGTAAACGGAGACTTCATCATCAGTAATGTTGACGGGAAAGGCACAGGG       c.1440
 Q  K  F  S  V  N  G  D  F  I  I  S  N  V  D  G  K  G  T  G         p.480

          .         .         .         .         .         .       g.123013
 ACCTACAGTTGCAGCTATCGCGTAGAGACACATCCTAACATCTGGTCACATCGCAGTGAG       c.1500
 T  Y  S  C  S  Y  R  V  E  T  H  P  N  I  W  S  H  R  S  E         p.500

          .         .      | 09  .         .         .         .    g.123400
 CCCCTGAAGCTGATGGGGCCAGCAG | GCTATCTCACCTGGAATTACGTTCTGAATGAAGCT    c.1560
 P  L  K  L  M  G  P  A  G |   Y  L  T  W  N  Y  V  L  N  E  A      p.520

          .         .         .         .         .         .       g.123460
 ATCAGGTTGTCTCTAATCATGCAGCTTGTTGCCTTGCTGTTGGTAGTGCTGTGGATAAGG       c.1620
 I  R  L  S  L  I  M  Q  L  V  A  L  L  L  V  V  L  W  I  R         p.540

          .         .       | 10 .         .         .         .    g.125396
 TGGAAGTGTCGGAGACTCAGAATCAG | AGAAGCCTGGTTGCTGGGAACAGCTCAAGGGGTC    c.1680
 W  K  C  R  R  L  R  I  R  |  E  A  W  L  L  G  T  A  Q  G  V      p.560

          .         .         .        | 11.         .         .    g.125536
 ACCATGCTCTTCATAGTCACGGCCCTTCTCTGCTGTG | CAATTTCTTTTGCAGGACTGTGC    c.1740
 T  M  L  F  I  V  T  A  L  L  C  C  A |   I  S  F  A  G  L  C      p.580

          .         .      | 12  .         .         .         .    g.125987
 AATGGGGTATTGATAGAAGAGACTG | AAATAGTCATGCCAACCCCTAAGCCTGAGCTGTGG    c.1800
 N  G  V  L  I  E  E  T  E |   I  V  M  P  T  P  K  P  E  L  W      p.600

          .         .         .         .         .         .       g.126047
 GCAGAGACCAACTTTCCTCTGGCCCCGTGGAAGAACTTAACCCTCTGGTGCAGAAGCCCT       c.1860
 A  E  T  N  F  P  L  A  P  W  K  N  L  T  L  W  C  R  S  P         p.620

          .         .         .         .         .         .       g.126107
 TCTGGCTCAACTAAGGAGTTTGTGTTGCTGAAGGATGGGACCGGGTGGATCGCCACTCGC       c.1920
 S  G  S  T  K  E  F  V  L  L  K  D  G  T  G  W  I  A  T  R         p.640

          .         .         .         .         .         .       g.126167
 CCGGCCTCAGAGCAGGTCCGGGCTGCCTTCCCCCTTGGCGCCCTGACCCAGAGCCACACC       c.1980
 P  A  S  E  Q  V  R  A  A  F  P  L  G  A  L  T  Q  S  H  T         p.660

          .         .         .         .         .         .       g.126227
 GGGAGCTACCACTGCCATTCATGGGAGGAGATGGCTGTATCGGAGCCCAGTGAGGCACTT       c.2040
 G  S  Y  H  C  H  S  W  E  E  M  A  V  S  E  P  S  E  A  L         p.680

          .       | 13 .         .         .         .         .    g.126613
 GAGCTGGTGGGGACAG | ACATCCTCCCCAAACCTGTCATTTCTGCTTCCCCCACAATCCGG    c.2100
 E  L  V  G  T  D |   I  L  P  K  P  V  I  S  A  S  P  T  I  R      p.700

          .         .         .         .         .         .       g.126673
 GGCCAGGAACTACAACTCCGGTGCAAAGGATGGCTGGCAGGCATGGGGTTTGCTCTGTAT       c.2160
 G  Q  E  L  Q  L  R  C  K  G  W  L  A  G  M  G  F  A  L  Y         p.720

          .         .         .         .         .         .       g.126733
 AAGGAGGGAGAGCAAGAACCTGTCCAGCAACTTGGTGCTGTTGGAAGAGAAGCCTTCTTT       c.2220
 K  E  G  E  Q  E  P  V  Q  Q  L  G  A  V  G  R  E  A  F  F         p.740

          .         .         .         .         .         .       g.126793
 ACAATCCAGAGAATGGAGGATAAAGACGAAGGCAATTACAGCTGCCGCACTCACACTGAA       c.2280
 T  I  Q  R  M  E  D  K  D  E  G  N  Y  S  C  R  T  H  T  E         p.760

          .         .         .         .         .      | 14  .    g.127482
 AAACGCCCCTTCAAGTGGTCTGAGCCCAGTGAGCCGCTGGAGCTTGTCATAAAAG | AAATG    c.2340
 K  R  P  F  K  W  S  E  P  S  E  P  L  E  L  V  I  K  E |   M      p.780

          .         .         .         .         .         .       g.127542
 TACCCTAAGCCCTTCTTCAAGACATGGGCCAGCCCTGTGGTCACCCCTGGTGCCCGAGTG       c.2400
 Y  P  K  P  F  F  K  T  W  A  S  P  V  V  T  P  G  A  R  V         p.800

          .         .         .         .         .         .       g.127602
 ACTTTCAATTGCTCCACCCCCCACCAGCATATGAGCTTTATTCTTTACAAAGATGGAAGT       c.2460
 T  F  N  C  S  T  P  H  Q  H  M  S  F  I  L  Y  K  D  G  S         p.820

          .         .         .         .         .         .       g.127662
 GAAATAGCATCCAGTGACAGGTCCTGGGCAAGTCCGGGGGCCAGTGCAGCTCACTTTCTA       c.2520
 E  I  A  S  S  D  R  S  W  A  S  P  G  A  S  A  A  H  F  L         p.840

          .         .         .         .         .         .       g.127722
 ATCATTTCGGTGGGCATTGGTGATGGAGGGAATTACAGCTGCCGATATTATGACTTTTCT       c.2580
 I  I  S  V  G  I  G  D  G  G  N  Y  S  C  R  Y  Y  D  F  S         p.860

          .         .         .         .    | 15    .         .    g.128472
 ATCTGGTCTGAGCCCAGCGACCCTGTGGAGCTCGTGGTGACAG | AATTCTACCCCAAACCC    c.2640
 I  W  S  E  P  S  D  P  V  E  L  V  V  T  E |   F  Y  P  K  P      p.880

          .         .         .         .         .         .       g.128532
 ACTCTCCTGGCACAGCCAGGTCCTGTGGTGTTTCCTGGGAAGAGTGTGATCCTGCGCTGC       c.2700
 T  L  L  A  Q  P  G  P  V  V  F  P  G  K  S  V  I  L  R  C         p.900

          .         .         .         .         .         .       g.128592
 CAAGGGACTTTCCAGGGCATGAGGTTCGCCCTCTTGCAGGAGGGAGCCCATGTTCCCTTA       c.2760
 Q  G  T  F  Q  G  M  R  F  A  L  L  Q  E  G  A  H  V  P  L         p.920

          .         .         .         .         .         .       g.128652
 CAGTTTCGGAGTGTCTCAGGGAACTCAGCTGACTTCCTTCTCCACACTGTTGGAGCAGAG       c.2820
 Q  F  R  S  V  S  G  N  S  A  D  F  L  L  H  T  V  G  A  E         p.940

          .         .         .         .         .         .       g.128712
 GACTCTGGGAACTATAGCTGTATCTACTATGAGACAACCATGTCAAACAGGGGGTCATAT       c.2880
 D  S  G  N  Y  S  C  I  Y  Y  E  T  T  M  S  N  R  G  S  Y         p.960

          .         .         .  | 16      .         .         .    g.128967
 CTCAGTATGCCCCTTATGATCTGGGTGACTG | ACACATTCCCTAAGCCATGGTTGTTTGCT    c.2940
 L  S  M  P  L  M  I  W  V  T  D |   T  F  P  K  P  W  L  F  A      p.980

          .         .         .         .         .         .       g.129027
 GAGCCCAGTTCTGTGGTTCCCATGGGGCAGAATGTTACTCTCTGGTGCCGAGGGCCGGTC       c.3000
 E  P  S  S  V  V  P  M  G  Q  N  V  T  L  W  C  R  G  P  V         p.1000

          .         .         .         .         .         .       g.129087
 CATGGAGTAGGATACATTCTGCACAAAGAAGGAGAAGCCACTTCAATGCAGCTCTGGGGA       c.3060
 H  G  V  G  Y  I  L  H  K  E  G  E  A  T  S  M  Q  L  W  G         p.1020

          .         .         .         .         .         .       g.129147
 TCCACCAGTAATGACGGGGCATTCCCCATCACCAATATATCTGGTACTAGCATGGGGCGT       c.3120
 S  T  S  N  D  G  A  F  P  I  T  N  I  S  G  T  S  M  G  R         p.1040

          .         .         .         .         .         .       g.129207
 TACAGCTGCTGCTACCACCCTGACTGGACCAGTTCTATCAAGATACAACCTAGCAACACC       c.3180
 Y  S  C  C  Y  H  P  D  W  T  S  S  I  K  I  Q  P  S  N  T         p.1060

          .          | 17        .         .         .         .    g.129458
 CTGGAACTCCTAGTCACAG | GCTTACTCCCCAAACCCAGCCTATTAGCCCAGCCTGGTCCC    c.3240
 L  E  L  L  V  T  G |   L  L  P  K  P  S  L  L  A  Q  P  G  P      p.1080

          .         .         .         .         .         .       g.129518
 ATGGTGGCCCCTGGCGAAAATATGACTCTTCAGTGTCAAGGGGAACTGCCAGACTCAACA       c.3300
 M  V  A  P  G  E  N  M  T  L  Q  C  Q  G  E  L  P  D  S  T         p.1100

          .         .         .         .         .         .       g.129578
 TTTGTCCTGTTGAAGGAGGGGGCTCAGGAGCCTTTAGAGCAACAGAGGCCAAGTGGGTAC       c.3360
 F  V  L  L  K  E  G  A  Q  E  P  L  E  Q  Q  R  P  S  G  Y         p.1120

          .         .         .         .         .         .       g.129638
 AGGGCTGACTTCTGGATGCCAGCAGTGAGAGGTGAAGACTCTGGGATCTATAGCTGTGTT       c.3420
 R  A  D  F  W  M  P  A  V  R  G  E  D  S  G  I  Y  S  C  V         p.1140

          .         .         .         .         .         .       g.129698
 TATTATTTGGACTCTACTCCCTTTGCAGCTTCAAATCACAGTGACTCCCTGGAGATCTGG       c.3480
 Y  Y  L  D  S  T  P  F  A  A  S  N  H  S  D  S  L  E  I  W         p.1160

         | 18.         .         .         .         .         .    g.129879
 GTGACTG | ATAAGCCCCCTAAACCCTCTCTGTCAGCCTGGCCCAGCACCATGTTCAAGTTA    c.3540
 V  T  D |   K  P  P  K  P  S  L  S  A  W  P  S  T  M  F  K  L      p.1180

          .         .         .         .         .         .       g.129939
 GGGAAGGACATCACCCTTCAGTGCCGAGGACCCCTGCCAGGTGTTGAATTTGTCCTAGAA       c.3600
 G  K  D  I  T  L  Q  C  R  G  P  L  P  G  V  E  F  V  L  E         p.1200

          .         .         .         .         .         .       g.129999
 CATGATGGAGAAGAAGCACCTCAGCAGTTTTCAGAGGATGGAGACTTTGTCATCAACAAC       c.3660
 H  D  G  E  E  A  P  Q  Q  F  S  E  D  G  D  F  V  I  N  N         p.1220

          .         .         .         .         .         .       g.130059
 GTAGAAGGAAAAGGCATTGGAAACTACAGCTGCAGCTACCGCCTCCAGGCCTACCCTGAT       c.3720
 V  E  G  K  G  I  G  N  Y  S  C  S  Y  R  L  Q  A  Y  P  D         p.1240

          .         .         .         .       | 19 .         .    g.130511
 ATCTGGTCAGAGCCTAGTGATCCCCTGGAGCTGGTGGGGGCAGCAG | GGCCTGTTGCTCAG    c.3780
 I  W  S  E  P  S  D  P  L  E  L  V  G  A  A  G |   P  V  A  Q      p.1260

          .         .         .         .         .         .       g.130571
 GAGTGCACTGTAGGGAACATTGTCCGAAGTAGCCTAATCGTGGTGGTTGTTGTAGCCTTG       c.3840
 E  C  T  V  G  N  I  V  R  S  S  L  I  V  V  V  V  V  A  L         p.1280

          .         .         .         .         . | 20       .    g.130782
 GGGGTAGTGCTAGCCATAGAGTGGAAGAAGTGGCCTCGACTGCGAACCAG | AGGCTCAGAG    c.3900
 G  V  V  L  A  I  E  W  K  K  W  P  R  L  R  T  R  |  G  S  E      p.1300

          .         .         .         .         .         .       g.130842
 ACAGACGGAAGAGACCAGACCATTGCCCTTGAAGAGTGTAACCAAGAAGGAGAACCAGGC       c.3960
 T  D  G  R  D  Q  T  I  A  L  E  E  C  N  Q  E  G  E  P  G         p.1320

          .         .         .         .         .         .       g.130902
 ACCCCTGCCAATTCTCCTTCATCAACCTCTCAGAGAATCTCTGTGGAACTGCCCGTTCCA       c.4020
 T  P  A  N  S  P  S  S  T  S  Q  R  I  S  V  E  L  P  V  P         p.1340

                                                                    g.130908
 ATATAA                                                             c.4026
 I  X                                                               p.1341

          .         .         .         .         .         .       g.130968
 taatctcctcctttacaagagctttcctctcctctctcttgctctcagagacctataaat       c.*60

          .         .         .         .         .         .       g.131028
 ccaaccagttaccctgcaagtcagccccatctgctgttccttggtctctaatcacctgag       c.*120

          .         .         .         .         .         .       g.131088
 ctgggtaaaggggattctgggagttgagagctctgccagggtgagatgtttcctgaagag       c.*180

          .         .         .         .         .         .       g.131148
 aggttccccacccctgtaactcctcactgtactgatttactggcgcatgaaattctatta       c.*240

          .         .         .         .         .                 g.131198
 aaaatgcattcttctgaataaaaagagtattcactatttaacttcaaaaa                 c.*290

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Immunoglobulin superfamily, member 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center