inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG) - 605 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)
         .         .         .         .         .         .  g.25770
gtgagggccctcctctctgacccaccctggcactgggacctggagagtctctttggcgtc  c.912+60

         .         .         .         .         .         .  g.25830
tttttttttttttttgcttttgctttttgagattgagttttgctcttgttgcccaggctg  c.912+120

         .         .         .         .         .         .  g.25890
gagtgccactagtggcacgatcttggctcactgcaacctctgcctcccgggttcaaacaa  c.912+180

         .         .         .         .         .         .  g.25950
ttctcttgcctcagcctcctgagtagctgggattacaggcgcctgccgccatgcccgtct  c.912+240

         .         .         .         .         .         .  g.26010
aatttttgtatttttagtagagacagggtttcaccatgttggcccagctggtctcgaact  c.912+300

     g.26013
tct  c.912+303

--------------------- middle of intron ---------------------
                                               g.26014        g.26015
                                               c.913-302  gg  c.913-301

.         .         .         .         .         .           g.26075
cctcaggtgatctgcccaccgcagtctctcaaagttctgggattacaggcgtgagccacc  c.913-241

.         .         .         .         .         .           g.26135
gcacccggcctctttggcatcattttgtagtggcctttcgtaagcttctgagccacttgt  c.913-181

.         .         .         .         .         .           g.26195
gctgctccttagacctctcggtgagcttggcattactcgccgacgtatctgtttcctctg  c.913-121

.         .         .         .         .         .           g.26255
cgccgctgggggctctgggaggacagcagtgggttctgctttgttcctgtggtgcctggc  c.913-61

.         .         .         .         .         .           g.26315
gcagtgcctggtgggtggctggcttgtggcgggcacatccctttctgttggatttgccag  c.913-1