inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG) - 298 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.26837
gtgagtgagcgagaactgggcctgcgggaggaggtgggtggggagggcaggtgctgcgcc  c.1117+60

         .         .         .         .         .         .  g.26897
gcgggaggtcacagttcgaccttcctgttgctctctggagacttgacggcgggagctcgt  c.1117+120

         .         .           g.26926
gtaggccaccccatcggtagcccaccccc  c.1117+149

--------------------- middle of intron ---------------------
                   g.26927              .         .           g.26955
                   c.1118-149  ttccccgaggctaagggaggcatgccgtg  c.1118-121

.         .         .         .         .         .           g.27015
gtagcggcggctcctggtcttacatgagtggcctgtgagaccaggcctgccattgacagt  c.1118-61

.         .         .         .         .         .           g.27075
cctgccaagtctccgtccccctccatcctccccttccctctgactcttctcttttcccag  c.1118-1


Powered by LOVD v.3.0 Build 05
©2004-2013 Leiden University Medical Center