interleukin 12 receptor, beta 1 (IL12RB1) - coding DNA reference sequence

(used for variant description)

(last modified August 17, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_005535.1 in the IL12RB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007366.1, covering IL12RB1 transcript NM_005535.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5004
                                                         ggtg       c.-61

 .         .         .         .         .         .                g.5064
 gctgaacctcgcaggtggcagagaggctcccctggggctgtggggctctacgtggatccg       c.-1

          .         .         .         .         .         .       g.5124
 ATGGAGCCGCTGGTGACCTGGGTGGTCCCCCTCCTCTTCCTCTTCCTGCTGTCCAGGCAG       c.60
 M  E  P  L  V  T  W  V  V  P  L  L  F  L  F  L  L  S  R  Q         p.20

      | 02   .         .         .         .         .         .    g.8452
 GGCG | CTGCCTGCAGAACCAGTGAGTGCTGTTTTCAGGACCCGCCATATCCGGATGCAGAC    c.120
 G  A |   A  C  R  T  S  E  C  C  F  Q  D  P  P  Y  P  D  A  D      p.40

      | 03   .         .         .         .         .         .    g.9679
 TCAG | GCTCGGCCTCGGGCCCTAGGGACCTGAGATGCTATCGGATATCCAGTGATCGTTAC    c.180
 S  G |   S  A  S  G  P  R  D  L  R  C  Y  R  I  S  S  D  R  Y      p.60

          .         .         .         .         .          | 04    g.10887
 GAGTGCTCCTGGCAGTATGAGGGTCCCACAGCTGGGGTCAGCCACTTCCTGCGGTGTTG | C    c.240
 E  C  S  W  Q  Y  E  G  P  T  A  G  V  S  H  F  L  R  C  C  |      p.80

          .         .         .         .         .         .       g.10947
 CTTAGCTCCGGGCGCTGCTGCTACTTCGCCGCCGGCTCAGCCACCAGGCTGCAGTTCTCC       c.300
 L  S  S  G  R  C  C  Y  F  A  A  G  S  A  T  R  L  Q  F  S         p.100

          .         .         .         .         .         .       g.11007
 GACCAGGCTGGGGTGTCTGTGCTGTACACTGTCACACTCTGGGTGGAATCCTGGGCCAGG       c.360
 D  Q  A  G  V  S  V  L  Y  T  V  T  L  W  V  E  S  W  A  R         p.120

          .         .         .         .          | 05        .    g.14243
 AACCAGACAGAGAAGTCTCCTGAGGTGACCCTGCAGCTCTACAACTCAG | TTAAATATGAG    c.420
 N  Q  T  E  K  S  P  E  V  T  L  Q  L  Y  N  S  V |   K  Y  E      p.140

          .         .         .         .         .         .       g.14303
 CCTCCTCTGGGAGACATCAAGGTGTCCAAGTTGGCCGGGCAGCTGCGTATGGAGTGGGAG       c.480
 P  P  L  G  D  I  K  V  S  K  L  A  G  Q  L  R  M  E  W  E         p.160

          .         .         .         .         .         .       g.14363
 ACCCCGGATAACCAGGTTGGTGCTGAGGTGCAGTTCCGGCACCGGACACCCAGCAGCCCA       c.540
 T  P  D  N  Q  V  G  A  E  V  Q  F  R  H  R  T  P  S  S  P         p.180

           | 06        .         .         . | 07       .         . g.16039
 TGGAAGTTG | GGCGACTGCGGACCTCAGGATGATGATACTG | AGTCCTGCCTCTGCCCCCTG c.600
 W  K  L   | G  D  C  G  P  Q  D  D  D  T  E |   S  C  L  C  P  L   p.200

          .         .         .         .         .         .       g.16099
 GAGATGAATGTGGCCCAGGAATTCCAGCTCCGACGACGGCAGCTGGGGAGCCAAGGAAGT       c.660
 E  M  N  V  A  Q  E  F  Q  L  R  R  R  Q  L  G  S  Q  G  S         p.220

          .         .         .         . | 08       .         .    g.18308
 TCCTGGAGCAAGTGGAGCAGCCCCGTGTGCGTTCCCCCTG | AAAACCCCCCACAGCCTCAG    c.720
 S  W  S  K  W  S  S  P  V  C  V  P  P  E |   N  P  P  Q  P  Q      p.240

          .         .         .         .         .         .       g.18368
 GTGAGATTCTCGGTGGAGCAGCTGGGCCAGGATGGGAGGAGGCGGCTGACCCTGAAAGAG       c.780
 V  R  F  S  V  E  Q  L  G  Q  D  G  R  R  R  L  T  L  K  E         p.260

     | 09    .         .         .         .         .         .    g.19595
 CAG | CCAACCCAGCTGGAGCTTCCAGAAGGCTGTCAAGGGCTGGCGCCTGGCACGGAGGTC    c.840
 Q   | P  T  Q  L  E  L  P  E  G  C  Q  G  L  A  P  G  T  E  V      p.280

          .         .         .         .         .         .       g.19655
 ACTTACCGACTACAGCTCCACATGCTGTCCTGCCCGTGTAAGGCCAAGGCCACCAGGACC       c.900
 T  Y  R  L  Q  L  H  M  L  S  C  P  C  K  A  K  A  T  R  T         p.300

          .         .         .         .         .         .       g.19715
 CTGCACCTGGGGAAGATGCCCTATCTCTCGGGTGCTGCCTACAACGTGGCTGTCATCTCC       c.960
 L  H  L  G  K  M  P  Y  L  S  G  A  A  Y  N  V  A  V  I  S         p.320

          .         .         .         .         .         .       g.19775
 TCGAACCAATTTGGTCCTGGCCTGAACCAGACGTGGCACATTCCTGCCGACACCCACACA       c.1020
 S  N  Q  F  G  P  G  L  N  Q  T  W  H  I  P  A  D  T  H  T         p.340

   | 10      .         .         .         .         .         .    g.22233
 G | AACCAGTGGCTCTGAATATCAGCGTCGGAACCAACGGGACCACCATGTATTGGCCAGCC    c.1080
 E |   P  V  A  L  N  I  S  V  G  T  N  G  T  T  M  Y  W  P  A      p.360

          .         .         .         .         .         .       g.22293
 CGGGCTCAGAGCATGACGTATTGCATTGAATGGCAGCCTGTGGGCCAGGACGGGGGCCTT       c.1140
 R  A  Q  S  M  T  Y  C  I  E  W  Q  P  V  G  Q  D  G  G  L         p.380

          .         .         .         .          | 11        .    g.23372
 GCCACCTGCAGCCTGACTGCGCCGCAAGACCCGGATCCGGCTGGAATGG | CAACCTACAGC    c.1200
 A  T  C  S  L  T  A  P  Q  D  P  D  P  A  G  M  A |   T  Y  S      p.400

          .         .         .         .         .         .       g.23432
 TGGAGTCGAGAGTCTGGGGCAATGGGGCAGGAAAAGTGTTACTACATTACCATCTTTGCC       c.1260
 W  S  R  E  S  G  A  M  G  Q  E  K  C  Y  Y  I  T  I  F  A         p.420

          .         .         .         .         .         .       g.23492
 TCTGCGCACCCCGAGAAGCTCACCTTGTGGTCTACGGTCCTGTCCACCTACCACTTTGGG       c.1320
 S  A  H  P  E  K  L  T  L  W  S  T  V  L  S  T  Y  H  F  G         p.440

         | 12.         .         .         .         .         .    g.25243
 GGCAATG | CCTCAGCAGCTGGGACACCGCACCACGTCTCGGTGAAGAATCATAGCTTGGAC    c.1380
 G  N  A |   S  A  A  G  T  P  H  H  V  S  V  K  N  H  S  L  D      p.460

          .         .         .         .         .         .       g.25303
 TCTGTGTCTGTGGACTGGGCACCATCCCTGCTGAGCACCTGTCCCGGCGTCCTAAAGGAG       c.1440
 S  V  S  V  D  W  A  P  S  L  L  S  T  C  P  G  V  L  K  E         p.480

          .         .         .         .    | 13    .         .    g.27894
 TATGTTGTCCGCTGCCGAGATGAAGACAGCAAACAGGTGTCAG | AGCATCCCGTGCAGCCC    c.1500
 Y  V  V  R  C  R  D  E  D  S  K  Q  V  S  E |   H  P  V  Q  P      p.500

          .         .         .         .         .         .       g.27954
 ACAGAGACCCAAGTTACCCTCAGTGGCCTGCGGGCTGGTGTAGCCTACACGGTGCAGGTG       c.1560
 T  E  T  Q  V  T  L  S  G  L  R  A  G  V  A  Y  T  V  Q  V         p.520

          .         .         .         .         .         | 14    g.29612
 CGAGCAGACACAGCGTGGCTGAGGGGTGTCTGGAGCCAGCCCCAGCGCTTCAGCATCG | AA    c.1620
 R  A  D  T  A  W  L  R  G  V  W  S  Q  P  Q  R  F  S  I  E |       p.540

          .         .         .         .         .         .       g.29672
 GTGCAGGTTTCTGATTGGCTCATCTTCTTCGCCTCCCTGGGGAGCTTCCTGAGCATCCTT       c.1680
 V  Q  V  S  D  W  L  I  F  F  A  S  L  G  S  F  L  S  I  L         p.560

          .         .         .      | 15  .         .         .    g.30715
 CTCGTGGGCGTCCTTGGCTACCTTGGCCTGAACAG | GGCCGCACGGCACCTGTGCCCGCCG    c.1740
 L  V  G  V  L  G  Y  L  G  L  N  R  |  A  A  R  H  L  C  P  P      p.580

          .         .         .         .         .  | 16      .    g.31811
 CTGCCCACACCCTGTGCCAGCTCCGCCATTGAGTTCCCTGGAGGGAAGGAG | ACTTGGCAG    c.1800
 L  P  T  P  C  A  S  S  A  I  E  F  P  G  G  K  E   | T  W  Q      p.600

          .         .         .         .         .         .       g.31871
 TGGATCAACCCAGTGGACTTCCAGGAAGAGGCATCCCTGCAGGAGGCCCTGGTGGTAGAG       c.1860
 W  I  N  P  V  D  F  Q  E  E  A  S  L  Q  E  A  L  V  V  E         p.620

          .         .         .         .         .         .       g.31931
 ATGTCCTGGGACAAAGGCGAGAGGACTGAGCCTCTCGAGAAGACAGAGCTACCTGAGGGT       c.1920
 M  S  W  D  K  G  E  R  T  E  P  L  E  K  T  E  L  P  E  G         p.640

          .         .         .         .         .         .       g.31991
 GCCCCTGAGCTGGCCCTGGATACAGAGTTGTCCTTGGAGGATGGAGACAGGTGCAAGGCC       c.1980
 A  P  E  L  A  L  D  T  E  L  S  L  E  D  G  D  R  C  K  A         p.660

     | 17                                                           g.32331
 AAG | ATGTGA                                                       c.1989
 K   | M  X                                                         p.662

          .         .         .         .                           g.32378
 tcgttgaggctcagagagggtgagtgactcgcccgaggctacgtagc                    c.*47

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Interleukin 12 receptor, beta 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center