interleukin 5 (colony-stimulating factor, eosinophil) (IL5) - coding DNA reference sequence

(used for mutation description)

(last modified July 9, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_000879.2 in the IL5 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_029547.1, covering IL5 transcript NM_000879.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5044
                 atgcactttctttgccaaaggcaaacgcagaacgtttcagagcc       c.-1

          .         .         .         .         .         .       g.5104
 ATGAGGATGCTTCTGCATTTGAGTTTGCTAGCTCTTGGAGCTGCCTACGTGTATGCCATC       c.60
 M  R  M  L  L  H  L  S  L  L  A  L  G  A  A  Y  V  Y  A  I         p.20

          .         .         .         .         .         .       g.5164
 CCCACAGAAATTCCCACAAGTGCATTGGTGAAAGAGACCTTGGCACTGCTTTCTACTCAT       c.120
 P  T  E  I  P  T  S  A  L  V  K  E  T  L  A  L  L  S  T  H         p.40

          .         .     | 02   .         .         .        | 03. g.6382
 CGAACTCTGCTGATAGCCAATGAG | ACTCTGAGGATTCCTGTTCCTGTACATAAAAAT | CAC c.180
 R  T  L  L  I  A  N  E   | T  L  R  I  P  V  P  V  H  K  N   | H   p.60

          .         .         .         .         .         .       g.6442
 CAACTGTGCACTGAAGAAATCTTTCAGGGAATAGGCACACTGGAGAGTCAAACTGTGCAA       c.240
 Q  L  C  T  E  E  I  F  Q  G  I  G  T  L  E  S  Q  T  V  Q         p.80

          .         .         .         .         .         .       g.6502
 GGGGGTACTGTGGAAAGACTATTCAAAAACTTGTCCTTAATAAAGAAATACATTGACGGC       c.300
 G  G  T  V  E  R  L  F  K  N  L  S  L  I  K  K  Y  I  D  G         p.100

        | 04 .         .         .         .         .         .    g.6667
 CAAAAA | AAAAAGTGTGGAGAAGAAAGACGGAGAGTAAACCAATTCCTAGACTACCTGCAA    c.360
 Q  K   | K  K  C  G  E  E  R  R  R  V  N  Q  F  L  D  Y  L  Q      p.120

          .         .         .         .                           g.6712
 GAGTTTCTTGGTGTAATGAACACCGAGTGGATAATAGAAAGTTGA                      c.405
 E  F  L  G  V  M  N  T  E  W  I  I  E  S  X                        p.134

          .         .         .         .         .         .       g.6772
 gactaaactggtttgttgcagccaaagattttggaggagaaggacattttactgcagtga       c.*60

          .         .         .         .         .         .       g.6832
 gaatgagggccaagaaagagtcaggccttaattttcagtataatttaacttcagagggaa       c.*120

          .         .         .         .         .         .       g.6892
 agtaaatatttcaggcatactgacactttgccagaaagcataaaattcttaaaatatatt       c.*180

          .         .         .         .         .         .       g.6952
 tcagatatcagaatcattgaagtattttcctccaggcaaaattgatatacttttttctta       c.*240

          .         .         .         .         .         .       g.7012
 tttaacttaacattctgtaaaatgtctgttaacttaatagtatttatgaaatggttaaga       c.*300

          .         .         .         .         .         .       g.7072
 atttggtaaattagtatttatttaatgttatgttgtgttctaataaaacaaaaatagaca       c.*360

                                                                    g.7079
 actgttc                                                            c.*367

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Interleukin 5 (colony-stimulating factor, eosinophil) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-06
©2004-2012 Leiden University Medical Center