IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L) - coding DNA reference sequence

(used for variant description)

(last modified December 20, 2013)

This file was created to facilitate the description of sequence variants on transcript NM_032549.3 in the IMMP2L gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering IMMP2L transcript NM_032549.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5249
                                      cggccgcgagtcctgcgtgatcg       c.-421

 .         .         .         .         .         .                g.5309
 cgagcatgtgtgcgtgcgcgtgtttatctgaggcgcgtgcggcggccaccccagcctagt       c.-361

 .         .         .         .         .         .                g.5369
 cctcttcttggtgccactggctaactaggttgagaaaccggcgccacaggcggcacacct       c.-301

 .         .         .         .         .         .                g.5429
 ggcccggagctggcccgctcctccccgccgagccggcgccccaacaacgcgccctctccc       c.-241

 .         .         .         .         .         .                g.5489
 agtcctcacaaaggggcctagtccggcccccggctctggccgtgagggagcgctgtgggg       c.-181

 .         .         .         .         .         .                g.5549
 gcgcgctgccttctgcctggaagtgttgggcaggtggtgggagagcgtcaggcttgaaca       c.-121

 .         .         .         .         .         .                g.5609
 acatgattttaaagcacgtgtctgtctgtcgttttttacttttagggttttggccaaatt       c.-61

 .         .         .         .         .         .        | 02    g.46070
 gggcgagggcacaaaataaccacttaccccttctcaccgaggaagagcgggagaaagg | gt    c.-1

          .         .         .         .         .         .       g.46130
 ATGGCACAGTCACAAGGGTGGGTGAAAAGATACATCAAGGCCTTTTGTAAAGGCTTCTTT       c.60
 M  A  Q  S  Q  G  W  V  K  R  Y  I  K  A  F  C  K  G  F  F         p.20

          .         .         .         .         .         .       g.46190
 GTGGCGGTGCCTGTGGCAGTGACTTTCTTGGATCGGGTCGCCTGTGTGGCAAGAGTAGAA       c.120
 V  A  V  P  V  A  V  T  F  L  D  R  V  A  C  V  A  R  V  E         p.40

          .      | 03  .         .         .         .         .    g.80221
 GGAGCATCGATGCAG | CCTTCTTTGAATCCTGGGGGGAGCCAGTCATCTGATGTGGTGCTT    c.180
 G  A  S  M  Q   | P  S  L  N  P  G  G  S  Q  S  S  D  V  V  L      p.60

          .         .         .         .         .          | 04    g.603953
 TTGAACCACTGGAAAGTGAGGAATTTTGAAGTACACCGTGGTGACATTGTATCATTGGT | G    c.240
 L  N  H  W  K  V  R  N  F  E  V  H  R  G  D  I  V  S  L  V  |      p.80

          .         .         .         .         .         .       g.604013
 TCTCCTAAAAACCCAGAACAGAAGATCATTAAGAGAGTGATTGCTCTTGAAGGAGATATT       c.300
 S  P  K  N  P  E  Q  K  I  I  K  R  V  I  A  L  E  G  D  I         p.100

       | 05  .         .         .         .         .         .    g.680877
 GTCAG | AACCATAGGACACAAAAACCGGTATGTCAAAGTCCCCCGTGGTCACATCTGGGTT    c.360
 V  R  |  T  I  G  H  K  N  R  Y  V  K  V  P  R  G  H  I  W  V      p.120

          .         .         .         .         | 06         .    g.903808
 GAAGGTGATCATCATGGACACAGTTTTGACAGTAATTCTTTTGGGCCG | GTTTCCCTAGGA    c.420
 E  G  D  H  H  G  H  S  F  D  S  N  S  F  G  P   | V  S  L  G      p.140

          .         .         .         .         .         .       g.903868
 CTTCTGCATGCCCATGCCACACATATCCTGTGGCCCCCAGAGCGCTGGCAGAAATTGGAA       c.480
 L  L  H  A  H  A  T  H  I  L  W  P  P  E  R  W  Q  K  L  E         p.160

          .         .         .         .                           g.903916
 TCTGTTCTTCCTCCAGAGCGCTTACCAGTACAGAGAGAAGAGGAATGA                   c.528
 S  V  L  P  P  E  R  L  P  V  Q  R  E  E  E  X                     p.175

          .         .         .         .         .         .       g.903976
 ctgcatgaatctacctgagttgctggcattgggaggccagttactggaaaggaatggaaa       c.*60

          .         .         .         .         .         .       g.904036
 aaagaagcctccaaaagggaaaaacttctgacaatatgatgctgtgcgagaaatatttac       c.*120

          .         .         .         .         .         .       g.904096
 agcacattaaaacgatctgtattattaaataaataattttcaaatgttaaacagtattaa       c.*180

          .         .         .         .         .         .       g.904156
 atggcacctgattttgtgttaaattttagttccctgttgtttaatgcccccaaaatatgc       c.*240

          .         .         .         .         .         .       g.904216
 agacctttgggaatataaaaatattgcacccacatgtcttaatggggctgaatttcagat       c.*300

          .         .         .         .         .         .       g.904276
 tatttgttacatatacttattatattgattgttgggttttgattttggtgcttgctgctg       c.*360

          .         .         .         .         .         .       g.904336
 aaataaattgaaaattaatattcaataaaaatgatgtatttgtcacttgctgttaaggta       c.*420

          .         .         .         .         .         .       g.904396
 gaacaagaaggaacacatattatacacataatgatgggaattacattgtgatttgtacta       c.*480

          .         .         .         .         .         .       g.904456
 tctacaaaggagtaactgccagttaggaagaacagtaaacagtgatgttaaaataaaaca       c.*540

          .                                                         g.904468
 atgatttgctaa                                                       c.*552

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.