interphotoreceptor matrix proteoglycan 2 (IMPG2) - coding DNA reference sequence

(used for variant description)

(last modified February 28, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_016247.3 in the IMPG2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_028284.1, covering IMPG2 transcript NM_016247.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5023
                                      agaaaagaagtgagagctacttt       c.-181

 .         .         .         .         .         .                g.5083
 gaaaggacaaccatttttctttccgctaatttataatggttttgaagtggttgttcattc       c.-121

 .         .         .         .         .         .                g.5143
 tcaaacatagacttttaaatgttaggtctttcctataactctttgttattggaagtttca       c.-61

 .         .         .         .         .         .                g.5203
 aggatttggacactcaattaaggattctgtcctctcctcattcctttggttttggcccaa       c.-1

          .         .         .         .         .         .       g.5263
 ATGATTATGTTTCCTCTTTTTGGGAAGATTTCTCTGGGTATTTTGATATTTGTCCTGATA       c.60
 M  I  M  F  P  L  F  G  K  I  S  L  G  I  L  I  F  V  L  I         p.20

          .         .      | 02  .         .         .         .    g.5778
 GAAGGAGACTTTCCATCATTAACAG | CACAAACCTACTTATCTATAGAGGAGATCCAAGAA    c.120
 E  G  D  F  P  S  L  T  A |   Q  T  Y  L  S  I  E  E  I  Q  E      p.40

          .         .         .         .         .         .       g.5838
 CCCAAGAGTGCAGTTTCTTTTCTCCTGCCTGAAGAATCAACAGACCTTTCTCTAGCTACC       c.180
 P  K  S  A  V  S  F  L  L  P  E  E  S  T  D  L  S  L  A  T         p.60

          .         .         .         .         .         .       g.5898
 AAAAAGAAACAGCCTCTGGACCGCAGAGAAACTGAAAGACAGTGGTTAATCAGAAGGCGG       c.240
 K  K  K  Q  P  L  D  R  R  E  T  E  R  Q  W  L  I  R  R  R         p.80

          .         .         .         .         .         .       g.5958
 AGATCTATTCTGTTTCCTAATGGAGTGAAAATCTGCCCAGATGAAAGTGTTGCAGAGGCT       c.300
 R  S  I  L  F  P  N  G  V  K  I  C  P  D  E  S  V  A  E  A         p.100

          .         .         .     | 03   .         .         .    g.21289
 GTGGCAAATCATGTGAAGTATTTTAAAGTCCGAG | TGTGTCAGGAAGCTGTCTGGGAAGCC    c.360
 V  A  N  H  V  K  Y  F  K  V  R  V |   C  Q  E  A  V  W  E  A      p.120

          .         .         .         .         .         .       g.21349
 TTCAGGACTTTTTGGGATCGACTTCCTGGGCGTGAGGAATATCATTACTGGATGAATTTG       c.420
 F  R  T  F  W  D  R  L  P  G  R  E  E  Y  H  Y  W  M  N  L         p.140

          .         .         .         .         .         .       g.21409
 TGTGAGGATGGAGTCACAAGTATATTTGAAATGGGCACAAATTTTAGTGAATCTGTGGAA       c.480
 C  E  D  G  V  T  S  I  F  E  M  G  T  N  F  S  E  S  V  E         p.160

          .         .  | 04      .         .         .    | 05    . g.48869
 CATAGAAGCTTAATCATGAAG | AAACTGACTTATGCAAAGGAAACTGTAAGCAG | CTCTGAA c.540
 H  R  S  L  I  M  K   | K  L  T  Y  A  K  E  T  V  S  S  |  S  E   p.180

          .         .         .         .    | 06    .         .    g.49847
 CTGTCTTCTCCAGTTCCTGTTGGTGATACTTCAACATTGGGAG | ACACTACTCTCAGTGTT    c.600
 L  S  S  P  V  P  V  G  D  T  S  T  L  G  D |   T  T  L  S  V      p.200

          .         .         .         .         .         .       g.49907
 CCACATCCAGAGGTGGACGCCTATGAAGGTGCCTCAGAGAGCAGCTTGGAAAGGCCAGAG       c.660
 P  H  P  E  V  D  A  Y  E  G  A  S  E  S  S  L  E  R  P  E         p.220

        | 07 .         .         .         .         .         .    g.51887
 GAGAGT | ATTAGCAATGAAATTGAGAATGTGATAGAAGAAGCCACAAAACCAGCAGGTGAA    c.720
 E  S   | I  S  N  E  I  E  N  V  I  E  E  A  T  K  P  A  G  E      p.240

          .         .         .         .         .         .       g.51947
 CAGATTGCAGAATTCAGTATCCACCTTTTGGGGAAGCAGTACAGGGAAGAACTACAGGAT       c.780
 Q  I  A  E  F  S  I  H  L  L  G  K  Q  Y  R  E  E  L  Q  D         p.260

          .         .         .         .         | 08         .    g.56014
 TCCTCCAGCTTTCACCACCAGCACCTTGAAGAAGAATTTATTTCAGAG | GTTGAAAATGCA    c.840
 S  S  S  F  H  H  Q  H  L  E  E  E  F  I  S  E   | V  E  N  A      p.280

          .         .         .         .        | 09.         .    g.58057
 TTTACTGGGTTACCAGGCTACAAGGAAATTCGTGTACTTGAATTTAG | GTCCCCCAAGGAA    c.900
 F  T  G  L  P  G  Y  K  E  I  R  V  L  E  F  R  |  S  P  K  E      p.300

          | 10         .         .         .         .         .    g.67854
 AATGACAG | TGGCGTAGATGTTTACTATGCAGTTACCTTCAATGGTGAGGCCATCAGCAAT    c.960
 N  D  S  |  G  V  D  V  Y  Y  A  V  T  F  N  G  E  A  I  S  N      p.320

          .         .         .         .         .         .       g.67914
 ACCACCTGGGACCTCATTAGCCTTCACTCCAACAAGGTGGAAAACCATGGCCTTGTGGAA       c.1020
 T  T  W  D  L  I  S  L  H  S  N  K  V  E  N  H  G  L  V  E         p.340

          .         .         .         .         .         .       g.67974
 CTGGATGATAAACCCACTGTTGTTTATACAATCAGTAACTTCAGAGATTATATTGCTGAG       c.1080
 L  D  D  K  P  T  V  V  Y  T  I  S  N  F  R  D  Y  I  A  E         p.360

          .         .         .         .         .         .       g.68034
 ACATTGCAGCAGAATTTTTTGCTGGGGAACTCTTCCTTGAATCCAGATCCTGATTCCCTG       c.1140
 T  L  Q  Q  N  F  L  L  G  N  S  S  L  N  P  D  P  D  S  L         p.380

          .    | 11    .         .         .         .         .    g.71841
 CAGCTTATCAATG | TGAGAGGAGTTTTGCGTCACCAAACTGAAGATCTAGTTTGGAACACC    c.1200
 Q  L  I  N  V |   R  G  V  L  R  H  Q  T  E  D  L  V  W  N  T      p.400

          .         .         .          | 12        .         .    g.79491
 CAAAGTTCAAGTCTTCAGGCAACGCCGTCATCTATTCTG | GATAATACCTTTCAAGCTGCA    c.1260
 Q  S  S  S  L  Q  A  T  P  S  S  I  L   | D  N  T  F  Q  A  A      p.420

          .         .         .         .         .         .       g.79551
 TGGCCCTCAGCAGATGAATCCATCACCAGCAGTATTCCACCACTTGATTTCAGCTCTGGT       c.1320
 W  P  S  A  D  E  S  I  T  S  S  I  P  P  L  D  F  S  S  G         p.440

          .         .         .         .         .         .       g.79611
 CCTCCCTCAGCCACTGGCAGGGAACTCTGGTCAGAAAGTCCTTTGGGTGATTTAGTGTCT       c.1380
 P  P  S  A  T  G  R  E  L  W  S  E  S  P  L  G  D  L  V  S         p.460

          .         .         .         .         .         .       g.79671
 ACACACAAATTAGCCTTTCCCTCGAAGATGGGCCTCAGCTCTTCCCCAGAGGTTTTAGAG       c.1440
 T  H  K  L  A  F  P  S  K  M  G  L  S  S  S  P  E  V  L  E         p.480

          .         .         .         .         .         .       g.79731
 GTTAGCAGCTTGACTCTTCATTCTGTCACCCCGGCAGTGCTTCAGACTGGCTTGCCTGTG       c.1500
 V  S  S  L  T  L  H  S  V  T  P  A  V  L  Q  T  G  L  P  V         p.500

          .         .         .         .    | 13    .         .    g.80805
 GCTTCTGAGGAAAGGACTTCTGGATCTCACTTGGTAGAAGATG | GATTAGCCAATGTTGAA    c.1560
 A  S  E  E  R  T  S  G  S  H  L  V  E  D  G |   L  A  N  V  E      p.520

          .         .         .         .         .         .       g.80865
 GAGTCAGAAGATTTTCTTTCTATTGATTCATTGCCTTCAAGTTCATTCACTCAACCTGTG       c.1620
 E  S  E  D  F  L  S  I  D  S  L  P  S  S  S  F  T  Q  P  V         p.540

          .         .         .         .         .         .       g.80925
 CCAAAAGAAACAATACCATCCATGGAAGACTCTGATGTGTCCTTAACATCTTCACCATAT       c.1680
 P  K  E  T  I  P  S  M  E  D  S  D  V  S  L  T  S  S  P  Y         p.560

          .         .         .         .         .         .       g.80985
 CTGACCTCTTCTATACCTTTTGGCTTGGACTCCTTGACCTCCAAAGTCAAAGACCAATTA       c.1740
 L  T  S  S  I  P  F  G  L  D  S  L  T  S  K  V  K  D  Q  L         p.580

          .         .         .         .         .         .       g.81045
 AAAGTGAGCCCTTTCCTGCCAGATGCATCCATGGAAAAAGAGTTAATATTTGACGGTGGT       c.1800
 K  V  S  P  F  L  P  D  A  S  M  E  K  E  L  I  F  D  G  G         p.600

          .         .         .         .         .         .       g.81105
 TTAGGTTCAGGGTCTGGGCAAAAGGTAGATCTGATTACTTGGCCATGGAGTGAGACTTCA       c.1860
 L  G  S  G  S  G  Q  K  V  D  L  I  T  W  P  W  S  E  T  S         p.620

          .         .         .         .         .         .       g.81165
 TCAGAGAAGAGCGCTGAACCACTGTCCAAGCCGTGGCTTGAAGATGATGATTCACTTTTG       c.1920
 S  E  K  S  A  E  P  L  S  K  P  W  L  E  D  D  D  S  L  L         p.640

          .         .         .         .         .         .       g.81225
 CCAGCTGAGATTGAAGACAAGAAACTAGTTTTAGTTGACAAAATGGATTCCACAGACCAA       c.1980
 P  A  E  I  E  D  K  K  L  V  L  V  D  K  M  D  S  T  D  Q         p.660

          .         .         .         .         .         .       g.81285
 ATTAGTAAGCACTCAAAATATGAACATGATGACAGATCCACACACTTTCCAGAGGAAGAG       c.2040
 I  S  K  H  S  K  Y  E  H  D  D  R  S  T  H  F  P  E  E  E         p.680

          .         .         .         .         .         .       g.81345
 CCTCTTAGTGGGCCTGCTGTGCCCATCTTCGCAGATACTGCAGCTGAATCTGCGTCTCTA       c.2100
 P  L  S  G  P  A  V  P  I  F  A  D  T  A  A  E  S  A  S  L         p.700

          .         .         .         .         .         .       g.81405
 ACCCTCCCCAAGCACATATCAGAAGTACCTGGTGTTGATGATTACTCAGTTACCAAAGCA       c.2160
 T  L  P  K  H  I  S  E  V  P  G  V  D  D  Y  S  V  T  K  A         p.720

          .         .         .         .         .         .       g.81465
 CCTCTTATACTGACATCTGTAGCAATCTCTGCCTCTACTGATAAATCAGATCAGGCAGAT       c.2220
 P  L  I  L  T  S  V  A  I  S  A  S  T  D  K  S  D  Q  A  D         p.740

          .         .         .         .         .         .       g.81525
 GCCATCCTAAGGGAGGATATGGAACAAATTACTGAGTCATCCAACTATGAATGGTTTGAC       c.2280
 A  I  L  R  E  D  M  E  Q  I  T  E  S  S  N  Y  E  W  F  D         p.760

          .         .         .         .         .         .       g.81585
 AGTGAGGTTTCAATGGTAAAGCCAGATATGCAAACTTTGTGGACTATATTGCCAGAATCA       c.2340
 S  E  V  S  M  V  K  P  D  M  Q  T  L  W  T  I  L  P  E  S         p.780

          .         .         .         .         .         .       g.81645
 GAGAGAGTTTGGACAAGAACTTCTTCCCTAGAGAAATTGTCCAGAGACATATTGGCAAGT       c.2400
 E  R  V  W  T  R  T  S  S  L  E  K  L  S  R  D  I  L  A  S         p.800

          .         .         .         .         .         .       g.81705
 ACACCACAGAGTGCTGACAGGCTCTGGTTATCTGTGACACAGTCTACCAAATTGCCTCCA       c.2460
 T  P  Q  S  A  D  R  L  W  L  S  V  T  Q  S  T  K  L  P  P         p.820

          .         .         .         .         .         .       g.81765
 ACCACAATCTCCACCCTGCTAGAGGATGAAGTAATTATGGGTGTACAGGATATTTCGTTA       c.2520
 T  T  I  S  T  L  L  E  D  E  V  I  M  G  V  Q  D  I  S  L         p.840

          .         .         .         .         .         .       g.81825
 GAACTGGACCGGATAGGCACAGATTACTATCAGCCTGAGCAAGTCCAAGAGCAAAATGGC       c.2580
 E  L  D  R  I  G  T  D  Y  Y  Q  P  E  Q  V  Q  E  Q  N  G         p.860

          .         .         .         .         .         .       g.81885
 AAGGTTGGTAGTTATGTGGAAATGTCAACAAGTGTTCACTCCACAGAGATGGTTAGTGTG       c.2640
 K  V  G  S  Y  V  E  M  S  T  S  V  H  S  T  E  M  V  S  V         p.880

          .         .         .         .         .         .       g.81945
 GCTTGGCCCACAGAAGGAGGAGATGACTTGAGTTATACCCAGACTTCAGGAGCTTTGGTG       c.2700
 A  W  P  T  E  G  G  D  D  L  S  Y  T  Q  T  S  G  A  L  V         p.900

          .         .         .         .         .         .       g.82005
 GTTTTCTTCAGCCTCCGAGTGACTAACATGATGTTTTCAGAAGATCTGTTTAATAAAAAC       c.2760
 V  F  F  S  L  R  V  T  N  M  M  F  S  E  D  L  F  N  K  N         p.920

          .         .         .         .   | 14     .         .    g.82686
 TCCTTGGAGTATAAAGCCCTGGAGCAAAGATTCTTAGAATTG | CTGGTTCCCTATCTCCAG    c.2820
 S  L  E  Y  K  A  L  E  Q  R  F  L  E  L   | L  V  P  Y  L  Q      p.940

          .         .         .         .         .         .       g.82746
 TCAAATCTCACGGGGTTCCAGAACTTAGAAATCCTCAACTTCAGAAATGGCAGCATTGTG       c.2880
 S  N  L  T  G  F  Q  N  L  E  I  L  N  F  R  N  G  S  I  V         p.960

          .         .         .         .         .         .       g.82806
 GTGAACAGTCGAATGAAGTTTGCCAATTCTGTCCCTCCTAACGTCAACAATGCGGTGTAC       c.2940
 V  N  S  R  M  K  F  A  N  S  V  P  P  N  V  N  N  A  V  Y         p.980

          .         .         .         .         .         .       g.82866
 ATGATTCTGGAAGACTTTTGTACCACTGCCTACAATACCATGAACTTGGCTATTGATAAA       c.3000
 M  I  L  E  D  F  C  T  T  A  Y  N  T  M  N  L  A  I  D  K         p.1000

          .         .   | 15     .         .         .         .    g.92622
 TACTCTCTTGATGTGGAATCAG | GTGATGAAGCCAACCCTTGCAAGTTTCAGGCCTGTAAT    c.3060
 Y  S  L  D  V  E  S  G |   D  E  A  N  P  C  K  F  Q  A  C  N      p.1020

          .         .         .         .         .         .       g.92682
 GAATTTTCAGAGTGTCTGGTCAACCCCTGGAGTGGAGAAGCAAAGTGCAGATGCTTCCCT       c.3120
 E  F  S  E  C  L  V  N  P  W  S  G  E  A  K  C  R  C  F  P         p.1040

          .         .         .         .         .         .       g.92742
 GGATACCTGAGTGTGGAAGAACGGCCCTGTCAGAGTCTCTGTGACCTACAGCCTGACTTC       c.3180
 G  Y  L  S  V  E  E  R  P  C  Q  S  L  C  D  L  Q  P  D  F         p.1060

          .         .         .         .         .    | 16    .    g.94437
 TGCTTGAATGATGGAAAGTGTGACATTATGCCTGGGCACGGGGCCATTTGTAG | GTGCCGG    c.3240
 C  L  N  D  G  K  C  D  I  M  P  G  H  G  A  I  C  R  |  C  R      p.1080

          .         .         .         .         .         .       g.94497
 GTGGGTGAGAACTGGTGGTACCGAGGCAAGCACTGTGAGGAATTTGTGTCTGAGCCCGTG       c.3300
 V  G  E  N  W  W  Y  R  G  K  H  C  E  E  F  V  S  E  P  V         p.1100

          .         .         .         .         .         .       g.94557
 ATCATAGGCATCACTATTGCCTCCGTGGTTGGACTTCTTGTCATCTTTTCTGCTATCATC       c.3360
 I  I  G  I  T  I  A  S  V  V  G  L  L  V  I  F  S  A  I  I         p.1120

          .         .         .         .         .         .       g.94617
 TACTTCTTCATCAGGACTCTCCAAGCACACCATGACAGGAGTGAAAGAGAGAGTCCCTTC       c.3420
 Y  F  F  I  R  T  L  Q  A  H  H  D  R  S  E  R  E  S  P  F         p.1140

    | 17     .         .         .         .         .         .    g.96043
 AG | TGGCTCCAGCAGGCAGCCTGACAGCCTCTCATCTATTGAGAATGCTGTGAAGTACAAC    c.3480
 S  |  G  S  S  R  Q  P  D  S  L  S  S  I  E  N  A  V  K  Y  N      p.1160

          .         .         .         .         .         .       g.96103
 CCCGTGTATGAAAGTCACAGGGCTGGATGTGAGAAGTATGAGGGACCCTATCCTCAGCAT       c.3540
 P  V  Y  E  S  H  R  A  G  C  E  K  Y  E  G  P  Y  P  Q  H         p.1180

          .         .         .         .         .         .       g.96163
 CCCTTCTACAGCTCTGCTAGCGGAGACGTGATTGGTGGGCTGAGCAGAGAAGAAATCAGA       c.3600
 P  F  Y  S  S  A  S  G  D  V  I  G  G  L  S  R  E  E  I  R         p.1200

          .         .         .    | 18    .         .         .    g.96726
 CAGATGTATGAGAGCAGTGAGCTTTCCAGAGAG | GAAATTCAAGAGAGAATGAGAGTTTTG    c.3660
 Q  M  Y  E  S  S  E  L  S  R  E   | E  I  Q  E  R  M  R  V  L      p.1220

          .         .         .         .         .    | 19    .    g.98601
 GAACTGTATGCCAATGATCCTGAGTTTGCAGCTTTTGTGAGAGAGCAACAAGT | GGAAGAG    c.3720
 E  L  Y  A  N  D  P  E  F  A  A  F  V  R  E  Q  Q  V  |  E  E      p.1240

                                                                    g.98607
 GTTTAA                                                             c.3726
 V  X                                                               p.1241

          .         .         .         .         .         .       g.98667
 ccaaaactcctgttctgaaactgattagaagcctggagaagatggagattacttgttact       c.*60

          .         .         .         .         .         .       g.98727
 tatgtcatataattaacctggattttaaacactgttggaagaagagttttctatgaaaaa       c.*120

          .         .         .         .         .         .       g.98787
 attaaatatagggcacactgtttttttttcagcttaagttttcagaatgtagtaagagat       c.*180

          .         .         .         .         .         .       g.98847
 gttaccatttttatttctataaagactgaatgctgtgtttaaataaattgaaaactacgt       c.*240

          .         .         .         .         .         .       g.98907
 aaactctggaaagtattctataagaaaaagctggacctaggatttagggctgcagttgct       c.*300

          .         .         .         .         .         .       g.98967
 gtctgcttctgaatcactgggggtgtctcctaagaactgtgcctcgggtttttcaatagg       c.*360

          .         .         .         .         .         .       g.99027
 aaaataaggtgagactcttccatggagaagtctggcttagtaagggaatattttggagca       c.*420

          .         .         .         .         .         .       g.99087
 tatttgttattgttgggtagaaggggaaacctttgaaatagtcttaatggatagtttata       c.*480

          .         .         .         .         .         .       g.99147
 atcaggcattcatctaaataaaattctttcttttttttgatcaaactgctaaagaaaaag       c.*540

          .         .         .         .         .         .       g.99207
 caaacttttttgctgcaggatagaattcgggttgtatttttatgcttctatcagtgtctt       c.*600

          .         .         .         .         .         .       g.99267
 gcatttcctgagcatattaatcaagaccatgttattgttatgttaactatgttaatatcc       c.*660

          .         .         .         .         .         .       g.99327
 tttttttcttagttttcaggatgaatgcatatatatatatatatatatatatatatatat       c.*720

          .         .         .         .         .         .       g.99387
 atatatatatatatatatatataaagtttagaagattcccattaatctaaagacaaattt       c.*780

          .         .         .         .         .         .       g.99447
 aatcacatgggcagggagggagtgagtgtcgggtcaagaccccagtgctgagaatatatt       c.*840

          .         .         .         .         .         .       g.99507
 ttgtttcttgattgctggactgaggttccctgattgcttctgaaatctaaagatgtcttg       c.*900

          .         .         .         .         .         .       g.99567
 ggcaaatcctgtctctcctctagttcctggtgtattaatttggaaaacagcacttaacta       c.*960

          .         .         .         .         .         .       g.99627
 cctcacataatatagatgagctcattttcattgcttctcctttgtgtaatacctcctgtc       c.*1020

          .         .         .         .         .         .       g.99687
 taaattaactcctgcttatacaaaacagggcaaagcttttattacaattaaaatatttta       c.*1080

          .         .         .         .         .         .       g.99747
 aaaactgaacagataggaagtccataccttatataaattttgacagaaaatggaaatttt       c.*1140

          .         .         .         .         .         .       g.99807
 cctctttccccctagtgttttttttgaatgggttgctttggagggggagaggaggaggcc       c.*1200

          .         .         .         .         .         .       g.99867
 aaatcatcatcatcatgatattaaattgcatatgcaataggttattattaatgcagatac       c.*1260

          .         .         .         .         .         .       g.99927
 tttatgctagatgtcttcatgcttgccaaaaccaattctgaacattttgatttatttctg       c.*1320

          .         .         .         .         .         .       g.99987
 accagatataaataaccagtataaactgaccataagataaaatacttggttcactttttt       c.*1380

          .         .         .         .         .         .       g.100047
 ttttctcaacttgatgactgccaattctgctcattatgaggacaccggaaactaaatatc       c.*1440

          .         .         .         .         .         .       g.100107
 tgggctcagtgcatgccacagtaaagctagtgaaagccttgaagatggccaggtattttg       c.*1500

          .         .         .         .         .         .       g.100167
 caaagtatgtatggataacaggttgtgtgtgtgtatgtgtgaatgtgtgtgtgcgtgtat       c.*1560

          .         .         .         .         .         .       g.100227
 gtgtgtgtgcgtgtgcgcgctaatgcgcatgtgcgcccgcgccaaggtggctcccttatc       c.*1620

          .         .         .         .         .         .       g.100287
 ctagcatttcctttcattccctactcacataatggatcctctaacagttcagtataggta       c.*1680

          .         .         .         .         .         .       g.100347
 cactttccactattttattgacatgttctagtcttaatattggataattagacactttcc       c.*1740

          .         .         .         .         .         .       g.100407
 actgggcccatttgaaaagtaattgataattacctttaagacattttaagtgttaatgat       c.*1800

          .         .         .         .         .         .       g.100467
 atttgtcactactaagtgcttagttttatttataaaactttcaaagttttctgtttaaga       c.*1860

          .         .         .         .         .         .       g.100527
 ctgtaaactgttttcctatactacgtgttagatgaaagtgtattttatcacaaattaacc       c.*1920

          .         .         .         .         .         .       g.100587
 ttagaatgcaactctttgaatgtgtgcttgctggaagaattccagatggacacaaatccc       c.*1980

          .         .         .         .         .         .       g.100647
 tctagggcaggtcaccatgcagaacacttaggagaagcacgaactgagccagaggagggt       c.*2040

          .         .         .         .         .         .       g.100707
 tgttgttttccacaaactaagcagtgaagtgggaatttgggaattctgacacacgtcacc       c.*2100

          .         .         .         .         .         .       g.100767
 atctctgatttccttttgcgtgaccttttcatgcaagagcaaaacacttagctcttcatg       c.*2160

          .         .         .         .         .         .       g.100827
 aatgtctgctccacaccaatgaaatggaagagtaaaggagcccctcaactatcagggaaa       c.*2220

          .         .         .         .         .         .       g.100887
 gaacaggaggcctcagttgaggaatacaacttttgtcctgcctttgctatagctgaacca       c.*2280

          .         .         .         .         .         .       g.100947
 ctgttgaaaggttgaagaacacagtttgcccagcaaagatccatccactcatgtacaaag       c.*2340

          .         .         .         .         .         .       g.101007
 caaagcactaaaggagctattagtttgatggaaaaaactacccctaaagagcttctttct       c.*2400

          .         .         .         .         .         .       g.101067
 aaaagaccttcctcgaaggtgatttaatggcatgtcatcatttaaaagtcttaggctgaa       c.*2460

          .         .         .         .         .         .       g.101127
 ctgtcatttacactgcacaattgaggaatgaaattttctgagtattagaacgttcttctt       c.*2520

          .         .         .         .         .         .       g.101187
 aacctagcaatataatattcaacaagactatcaccttatgtgaaaatactaaaatgcagt       c.*2580

          .         .         .         .         .         .       g.101247
 tagcaataaaatgcatggtaaataaccattttaaaaatgttattataaaaggttgtaaga       c.*2640

          .         .         .         .         .         .       g.101307
 tactgtggtgttttacagatgtagcctttataattgaattatatacactatcctttttta       c.*2700

          .         .         .         .         .         .       g.101367
 tgggttatggataaaggggaatttatttgataaatagggctccattttcaccattgcaat       c.*2760

          .         .         .         .         .         .       g.101427
 ggtttaagggtgtttgttcacgtttatgtggcctgaagtcccatttttatcactattatt       c.*2820

          .         .         .         .         .         .       g.101487
 atttgagatggagtctcgctctgtcacccaggctggagtgcaatggggcgatctcagctc       c.*2880

          .         .         .         .         .         .       g.101547
 ctggcaacctctgcctcctgggttcaagcgattctcgtgcttcagcttcctgagtagctg       c.*2940

          .         .         .         .         .         .       g.101607
 gggttacagacacccaccaccatgcccagctaatttttatatttttagtagagatggggt       c.*3000

          .         .         .         .         .         .       g.101667
 ttcaccgtcaccatgttggccagcctggtctcaaactcctgacctcaggtgatccacctg       c.*3060

          .         .         .         .         .         .       g.101727
 ccttggcctcccaaagtgctgggattacaggcatgagccaccgcacctggccccatttaa       c.*3120

          .         .         .         .         .         .       g.101787
 tttatataataaaacaagtgcaggctttacctgattttattctcaccttctgttttcttc       c.*3180

          .         .         .         .         .         .       g.101847
 ttctgcattatctgtcaccatgggttggctcctccccactttctcttttttattcttttc       c.*3240

          .         .         .         .         .         .       g.101907
 tctcttttttgccacactaaattgtaatgtgtttgaacaactctgacttaatattacctc       c.*3300

          .         .         .         .         .         .       g.101967
 taacaaaaagctggaaactgcacaaatattctttgtaggctctaaaagtaggttggctga       c.*3360

          .         .         .         .         .         .       g.102027
 agtatgatacctgaactaattattcatttgtatgcttgttttataagtttgacttccatt       c.*3420

          .         .         .         .         .         .       g.102087
 tcatgatttttttggtagctttatgttatttctgttttcagcaatgggtactttgacatc       c.*3480

          .         .         .         .         .         .       g.102147
 tttctgtctctgaattgaattttcattttgcaacggaagagaagacaacatatttattcc       c.*3540

          .         .         .         .         .         .       g.102207
 ataatgaaagagctaatgaagtagaataactattaaattgagatgttttagcaaaaaaac       c.*3600

          .         .         .         .         .         .       g.102267
 aaaaacacaaaccccaaacgggttgttttgttttatttttttctaaaacatttctaacaa       c.*3660

          .         .         .         .         .         .       g.102327
 ttcccagtaggaatgggtggggccagccttcctcatttacaatccagctgcagtgagtca       c.*3720

          .         .         .         .         .         .       g.102387
 agatcctagcttattctcccaattgtgtaataaatgcagaaaaatgatgtgacggtcact       c.*3780

          .         .         .         .         .         .       g.102447
 attctcaaatccattgcattgtattccacaaaggatatcctggcggaaggtggaaatatg       c.*3840

          .         .         .         .         .         .       g.102507
 ggagggtaccatgatgtaaagaattgcctggaaatttccttgagtcatgcattttgtaaa       c.*3900

          .         .         .         .         .         .       g.102567
 accttacattactgctatgagttaataagagacaggttaaaccactcccctcaggatagt       c.*3960

          .         .         .         .         .         .       g.102627
 aagactggttaaaaacactgctctcagcccacacagttatagctacagcctaggttaaat       c.*4020

          .         .         .         .         .         .       g.102687
 gattcctcatcctggtgtttttattctcatgtttaattacttctttaaagattaagatta       c.*4080

          .         .         .         .         .         .       g.102747
 tatatagaaaaaataattgtggtatcagagaatacaggtataatttttcatatatcagga       c.*4140

          .         .         .         .         .         .       g.102807
 ctatgtgatgatacttaagcaatagtgtacatacagtaatatatgtttaatatcgagtat       c.*4200

          .         .         .         .         .         .       g.102867
 ggataatgaaggacttttctttttcaccttgtttataatgacattttatccagggtttga       c.*4260

          .         .         .         .         .         .       g.102927
 atcaaataaattcatgttaactgtactattttattgaaatgttctagtcttattattgga       c.*4320

          .         .         .         .         .         .       g.102987
 taattagaaataaacattttaaagtctttatgaataaataaggatgttttcctatgtata       c.*4380

          .         .         .         .                           g.103030
 caactgtactattttcattagtaataaacatcactttcaagaa                        c.*4423

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Interphotoreceptor matrix proteoglycan 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center