interphotoreceptor matrix proteoglycan 2 (IMPG2) - downstream reference sequence


         .         .         .         .            .         . g.103047
caactgtactattttcattagtaataaacatcactttcaagaa / cctgtctacatttgttt c.*4440

         .         .         .         .         .         .    g.103107
ttgtcaattagaggaaaattgtagatcttagcaacagttgaattgtaatgaccatttaaa    c.*4500

         .         .         .         .         .         .    g.103167
gacacatgctatgtaagcattgtgtgaaaatgaaaatctttctttgatttatctttgcga    c.*4560

         .         .         .         .         .         .    g.103227
agtgaagattaggagaactggagatgaatttggagcctcagtcttgcctcaaattttgtt    c.*4620

         .         .         .         .         .         .    g.103287
gtatttaatgatgatgggtcattatttggccgttcttaaactttactcttttaaactgtt    c.*4680

         .         .         .         .         .         .    g.103347
agaaactctcttttttttccccctcatctgcttaaggtaggaatggaaggaaaactgatg    c.*4740

         .         .         .         .         .         .    g.103407
aagctgattaaagaaagatttgatggtatagctagcaccagctgtctgtaaggagaggcg    c.*4800

         .         .         .         .         .         .    g.103467
aaatgggtgacctgtctaaagagaaaagagaagaaataaacatggtagcaacgatctaaa    c.*4860

         .         .         .         .         .         .    g.103527
gcaatcttgcatgggaggggcaggaggaaaatcagctaccagttatccaagcaggtgatt    c.*4920

         .         .         .         .         .         .    g.103587
cctcagtgcgttggccatcagaaacctcagttttcagttttattccttcctacctttgca    c.*4980

         .         .         .         .         .         .    g.103647
tgatgtcttgctggcaacaggacatgaagaaatcgtaaatcagtcttagaaaataggagg    c.*5040

         .         .         .         .         .         .    g.103707
gtggtcttacaatgagaacatttggacacaggatggggaacatcacacacccggacctgt    c.*5100

         .         .         .         .         .         .    g.103767
cgtggggtggggggaggggggagggatagcattaggagatatatctgatgcaaatgacga    c.*5160

         .         .         .         .         .         .    g.103827
gttaatgggtgcaccacaccaacatggcagatgtatacatatgtaacaaaccttcacgtt    c.*5220

         .         .         .         .         .         .    g.103887
gtgcacatgtaccctagaacttaaagtattatataaaaaaagaaaaaaaataggagggtg    c.*5280

         .         .         .         .         .         .    g.103947
gtcttgatttgactccaaagaccatattataaaaacaaaaagtaggggaaatatgcctaa    c.*5340

         .         .         .         .         .         .    g.104007
taaatatctgttgattgattaataagtgacctggttttaggagaaacagtgagtaataac    c.*5400

         .         .         .         .         .         .    g.104067
cctgcttttaagaagtctggtccggacaagccctagtcacttttagctcatgctctcaca    c.*5460

         .         .         .         .         .         .    g.104127
atgctggtccactttctagttcctctgaatttatgtcccatatgaactagtccttatggg    c.*5520

         .         .         .         .         .         .    g.104187
ctgtgcttcatgagctaatcttgaaattatcttctcaccaaaactcacatatcttgtccc    c.*5580

         .         .         .         .         .         .    g.104247
cccgccgcaccccctgtctgtaagaacaaatgaattgatgctaatatgataataggtgtt    c.*5640

         .         .         .         .         .         .    g.104307
cagaaatcagtcttttccaagtaacaccaacattgtgtgtggacttttgggaaacagctc    c.*5700

         .         .         .         .         .         .    g.104367
attatctcagattaataattctcattgtcaatattgcacacaccatggtaggtttcggga    c.*5760

         .         .         .         .         .         .    g.104427
agagtgtgcatattttcatcaggtgggcctttcaatgagcctcaaaaaattattcgttca    c.*5820

         .         .         .         .         .         .    g.104487
tgcctttttctgtacacgtatatgcttccattctgttattcactaaagctgtattataat    c.*5880

         .         .         .         .         .         .    g.104547
tttttattcatgtcattaacttcccactaaactgagttttttttgatgttagggccatgc    c.*5940

         .         .         .         .         .         .    g.104607
cttattcatttgctatttgcaaaaccaaagagtacttgatgtagagttggtttacaataa    c.*6000

         .         .         .         .         .         .    g.104667
tgagcaattcagttagcttgaaataatgggaggtatctgttttatcaccagcaagcaaat    c.*6060

         .         .         .         .         .         .    g.104727
ggttaccttgtataccaggaacaaattaggtggaccctgaatggtttaaaaatcactttt    c.*6120

         .         .         .         .         .         .    g.104787
aaagagatggtttacagagatttaaaaatagcactaaatatttcacgagataaaattgat    c.*6180

         .         .         .         .         .         .    g.104847
acatttatatctaccttattctcctctggtaattcatagaatgtatggactgctacattc    c.*6240

         .         .         .         .         .         .    g.104907
catacattgtatgtccacatgtagtaacctttccgagtttcctaaccatagactcaatga    c.*6300

         .         .         .         .         .         .    g.104967
agaaggcaggatgaagaggtagaatggtttggggactggtggtaggatagtaggaaaaat    c.*6360

         .         .         .         .         .         .    g.105027
ttaggtgctgtggctcagagaggggtaaaaactgaggagcttgtggggatagatgggaac    c.*6420

                                                                g.105030
aat                                                             c.*6423


Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center