interphotoreceptor matrix proteoglycan 2 (IMPG2) - 918 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.48972
gtatacttttgtgtcttcattcacttttcttttaaaattatttatggtttaagacaggct  c.583+60

         .         .         .         .         .         .  g.49032
cacaaacaagtacattttttgcagcttaccttttaaaaatatcagatttctcttttttaa  c.583+120

         .         .         .         .         .         .  g.49092
tacgtttttcaagagtctcaagaaaaagtaatttttaaaaatttattttatggcattatg  c.583+180

         .         .         .         .         .         .  g.49152
ttgtgggtacctaaaactccttaatcattaagtatataatacaagtcagaacaccactta  c.583+240

         .         .         .         .         .         .  g.49212
aaacaaatgtatgagctaatgaattattttaaggcaaacactctgtagccaccactaatg  c.583+300

         .         .         .         .         .         .  g.49272
tcaaaacgtagaaccattctaacgccaccatttgtcattcgtcccatgagaggttcccag  c.583+360

         .         .         .         .         .         .  g.49332
agtaaggattttcttattgcattctgtggtatagtttaacatgttcctttgcccagtata  c.583+420

         .         .         .           g.49371
tttcttgtaaattggtaattcatttctttatttttaatt  c.583+459

--------------------- middle of intron ---------------------
          g.49372             .         .         .           g.49410
          c.584-459  aaaaaaccccacaaacttctctgtgttagaaatttcaaa  c.584-421

.         .         .         .         .         .           g.49470
catctacaaaaatagaataacatgataaggtccagttttaacacttgtcaattcacaacc  c.584-361

.         .         .         .         .         .           g.49530
aatttccaacctttacccacttctcctctctggtagaggagttacttcttttagtatgtg  c.584-301

.         .         .         .         .         .           g.49590
tcccctttactagatagctccttaagtagaggaatattgtctttgtgttcctagtgtctt  c.584-241

.         .         .         .         .         .           g.49650
gtgcagagtctggcatatagtaggtgctcaatatatgcttgttgaacgtaccacaattat  c.584-181

.         .         .         .         .         .           g.49710
ttcttgttctgagaaggctccatacaaatatgtcctgaggttagaatgcaccgaatttcc  c.584-121

.         .         .         .         .         .           g.49770
aggacaataaaacaaactatttataggaatggtttttgaagtcagttccttatttcctga  c.584-61

.         .         .         .         .         .           g.49830
taggaattctgacttaatcgaggactgaattcatgcatatgtttttgcttttcttcttag  c.584-1


Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center