inverted formin, FH2 and WH2 domain containing (INF2) - 274 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.28008
gcaagtgggcacctgggcctggggctggcgggagaggctgccctgatagagtgagctggg  c.2610+60

         .         .         .         .         .         .  g.28068
cgagtggctgtgctgtctcctggctccagggtggatcctggggcccgagtttccccaggt  c.2610+120

         .         g.28085
gtgcatggtcagggcac  c.2610+137

--------------------- middle of intron ---------------------
                               g.28086            .           g.28102
                               c.2611-137  aggcccctgctccttgt  c.2611-121

.         .         .         .         .         .           g.28162
cagagaccaccgtcctcagggcctgtccctgtggccgtcaccctcccgcaactcagggcc  c.2611-61

.         .         .         .         .         .           g.28222
tcaccccgggtggtgcccgcgcggggctctcacgggactgtcacgtgcccttgcccccag  c.2611-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center