insulin (INS) - coding DNA reference sequence

(used for variant description)

(last modified April 18, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_000207.2 in the INS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007114.1, covering INS transcript NM_000207.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .   | 02     .             g.5223
  agccctccaggacaggctgcatcagaagaggccatcaagcag | atcactgtccttctgcc    c.-1

          .         .         .         .         .         .       g.5283
 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC       c.60
 M  A  L  W  M  R  L  L  P  L  L  A  L  L  A  L  W  G  P  D         p.20

          .         .         .         .         .         .       g.5343
 CCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTAC       c.120
 P  A  A  A  F  V  N  Q  H  L  C  G  S  H  L  V  E  A  L  Y         p.40

          .         .         .         .         .         .       g.5403
 CTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGAC       c.180
 L  V  C  G  E  R  G  F  F  Y  T  P  K  T  R  R  E  A  E  D         p.60

         | 03.         .         .         .         .         .    g.6250
 CTGCAGG | TGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTG    c.240
 L  Q  V |   G  Q  V  E  L  G  G  G  P  G  A  G  S  L  Q  P  L      p.80

          .         .         .         .         .         .       g.6310
 GCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGC       c.300
 A  L  E  G  S  L  Q  K  R  G  I  V  E  Q  C  C  T  S  I  C         p.100

          .         .         .                                     g.6343
 TCCCTCTACCAGCTGGAGAACTACTGCAACTAG                                  c.333
 S  L  Y  Q  L  E  N  Y  C  N  X                                    p.110

          .         .         .         .         .         .       g.6403
 acgcagcccgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaag       c.*60

          .                                                         g.6416
 cccttgaaccagc                                                      c.*73

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Insulin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.