iron-sulfur cluster assembly 1 homolog (S. cerevisiae) (ISCA1) - coding DNA reference sequence

(used for variant description)

(last modified July 28, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_030940.3 in the ISCA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering ISCA1 transcript NM_030940.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5057
    aggactgagggcgccgtgcgccgaagcttgtggcgtcaatgcgcccgccgtgtccat       c.-61

 .         .         .         .         .         .                g.5117
 ggagagaagctgaggcggccgaccttcggcccgaggcaccggggcgccgggacggcgaag       c.-1

          .         .         .         .         .         .       g.5177
 ATGTCGGCTTCCTTAGTCCGGGCAACTGTCCGGGCTGTGAGCAAGAGGAAGCTGCAGCCC       c.60
 M  S  A  S  L  V  R  A  T  V  R  A  V  S  K  R  K  L  Q  P         p.20

          .         .  | 02      .         .         .         .    g.13372
 ACCCGGGCAGCCCTCACCCTG | ACACCTTCAGCAGTAAACAAGATAAAACAACTTCTTAAA    c.120
 T  R  A  A  L  T  L   | T  P  S  A  V  N  K  I  K  Q  L  L  K      p.40

          .      | 03  .         .         .         .         .    g.15508
 GATAAGCCTGAGCAT | GTAGGTGTAAAAGTTGGTGTCCGAACCAGGGGCTGTAATGGCCTT    c.180
 D  K  P  E  H   | V  G  V  K  V  G  V  R  T  R  G  C  N  G  L      p.60

          .         .         .         .         .         .       g.15568
 TCTTATACTCTAGAATATACAAAGACAAAAGGAGATTCTGATGAAGAAGTTATTCAAGAT       c.240
 S  Y  T  L  E  Y  T  K  T  K  G  D  S  D  E  E  V  I  Q  D         p.80

   | 04      .         .         .         .         .         .    g.21443
 G | GAGTCAGAGTATTCATCGAAAAGAAAGCACAGCTAACACTTTTAGGAACAGAAATGGAC    c.300
 G |   V  R  V  F  I  E  K  K  A  Q  L  T  L  L  G  T  E  M  D      p.100

          .         .         .         .         .         .       g.21503
 TATGTTGAAGACAAATTATCCAGTGAGTTTGTGTTCAATAACCCAAACATCAAAGGGACT       c.360
 Y  V  E  D  K  L  S  S  E  F  V  F  N  N  P  N  I  K  G  T         p.120

          .         .         .                                     g.21533
 TGTGGCTGTGGAGAAAGCTTTAATATTTGA                                     c.390
 C  G  C  G  E  S  F  N  I  X                                       p.129

          .         .         .         .         .         .       g.21593
 aatctcaggactcttctggccgtaggttccaggaaagctcgtggaagctttggggctcac       c.*60

          .         .         .         .         .         .       g.21653
 tgcagaaatcatgtgactgtcacgtgctggaaaataaagtgatacatcttgaaaatgaat       c.*120

          .         .         .         .         .         .       g.21713
 ccagtgtgttggattccagaagaaatgatatttatattctctataggggacagaaaatga       c.*180

          .         .         .         .         .         .       g.21773
 gaagccatcactctttttggatcatttaggtctcttgtatcctttgttttagaaccagtt       c.*240

          .         .         .         .         .         .       g.21833
 tcattaaagttgccttcctgggcacctgtttatccatttcctgaactgtgtgcactcctt       c.*300

          .         .         .         .         .         .       g.21893
 agatcgctattgatggcttgatcatccctcagcatttctcccaaccagatcggtgactcc       c.*360

          .         .         .         .         .         .       g.21953
 taaaatctgagacaggacatcgtgactgctggtagtaatatggtggtgcattgttttttc       c.*420

          .         .         .         .         .         .       g.22013
 cacccaaacttaacatagcctttttatacatttttatgaaaaatttcattgtcagctgcc       c.*480

          .         .         .         .         .         .       g.22073
 tcactgcatactctttaatagtaccaggcaaagattttcttcaactatagtacagattag       c.*540

          .         .         .         .         .         .       g.22133
 ttctgagtgatggtatcaaaaggtgagaaagacgtcatccgcctttttttaatccatttc       c.*600

          .         .         .         .         .         .       g.22193
 ttttgccaccctatatgtctgttcagagatgggctctcaagctgactttgattcttttag       c.*660

          .         .         .         .         .         .       g.22253
 ttgagaagtctcttaaagccatctagcccacctccatcaattccctatgtgaggaagcaa       c.*720

          .         .         .         .         .         .       g.22313
 aaccccagggaagccaaagggctcctgtccaccctgacaccacaggccgggggagagtag       c.*780

          .         .         .         .         .         .       g.22373
 ggactctacccccctctccccttgtaggtgacacatgctctgccctctgaggcagtcagc       c.*840

          .         .         .         .         .         .       g.22433
 gaaggcaaatggtctgacttctttatgtggtcaacattttgatagaatttctttataatt       c.*900

          .         .         .         .         .         .       g.22493
 tgatagagattatattatttttattttattttgagtgggaagaattttaaaaccttttta       c.*960

          .         .         .         .         .         .       g.22553
 tgtcaattaccatcttgtttctttcacctttgaaacaatggtttgtagcagagatgacat       c.*1020

          .         .         .         .         .         .       g.22613
 tgtagcaacccagaattatgcttttggaatgtggtcctcactgtacaggagaatgtgtaa       c.*1080

          .         .         .         .         .         .       g.22673
 tcttttgttaaaattcccagtgtgcatacattttctggttcctcggtccagttgctaaag       c.*1140

          .         .         .         .         .         .       g.22733
 ttcttagtattttagcctaacatatttatcaccaacttttctttaaaagtgttccttttg       c.*1200

          .         .         .         .         .         .       g.22793
 tcacttagttactgattttcctgggtttgacataagtattctatgagatgatatatatgc       c.*1260

          .         .         .         .         .         .       g.22853
 tttttttgaaagctgattctcatgaattcaagtagctgagttcctttatgtttcgtttat       c.*1320

          .         .         .         .         .         .       g.22913
 tcactaaagtagctgacacaaaacacaccaaaacctagagcggtagttttatgtaaatgc       c.*1380

          .         .         .         .         .         .       g.22973
 tcatgagtttgtatcaataatataattgttgatccacttataattcgtgcaacactgtat       c.*1440

          .         .         .         .         .                 g.23030
 gtatgtagagattgagttgtcaattaaaaaaaatgtggcctctttgtgatcataaaa          c.*1497

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Iron-sulfur cluster assembly 1 homolog (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.