iron-sulfur cluster assembly 2 homolog (S. cerevisiae) (ISCA2) - coding DNA reference sequence

(used for variant description)

(last modified March 8, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_194279.2 in the ISCA2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_033074.1, covering ISCA2 transcript NM_194279.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 acgcgaggggcggagcttgtggaggaag       c.-1

          .         .         .         .         .         .       g.5088
 ATGGCTGCCGCCTGGGGGTCGTCCCTAACGGCCGCGACGCAGAGAGCGGTCACTCCCTGG       c.60
 M  A  A  A  W  G  S  S  L  T  A  A  T  Q  R  A  V  T  P  W         p.20

          .  | 02      .         .         .         .         .    g.5352
 CCGAGGGGCAG | GCTCCTCACGGCCTCCCTGGGACCCCAGGCGCGTCGGGAGGCGTCGTCC    c.120
 P  R  G  R  |  L  L  T  A  S  L  G  P  Q  A  R  R  E  A  S  S      p.40

          .         .         .         .         .     | 03   .    g.5534
 TCCAGCCCCGAGGCCGGCGAAGGGCAGATCCGCCTCACAGACAGTTGCGTCCAG | AGGCTT    c.180
 S  S  P  E  A  G  E  G  Q  I  R  L  T  D  S  C  V  Q   | R  L      p.60

          .         .         .         .         .         .       g.5594
 TTGGAAATCACCGAAGGGTCAGAATTCCTCAGGCTGCAAGTGGAGGGAGGTGGATGCTCC       c.240
 L  E  I  T  E  G  S  E  F  L  R  L  Q  V  E  G  G  G  C  S         p.80

          .         .         .         .         . | 04       .    g.6089
 GGATTCCAATACAAATTTTCACTGGATACAGTTATCAACCCCGACGACAG | GGTATTTGAA    c.300
 G  F  Q  Y  K  F  S  L  D  T  V  I  N  P  D  D  R  |  V  F  E      p.100

          .         .         .         .         .         .       g.6149
 CAGGGTGGGGCAAGAGTGGTGGTTGACTCTGATAGCTTGGCCTTCGTGAAAGGGGCCCAG       c.360
 Q  G  G  A  R  V  V  V  D  S  D  S  L  A  F  V  K  G  A  Q         p.120

          .         .         .         .         .         .       g.6209
 GTGGACTTCAGCCAAGAACTGATCCGAAGCTCATTTCAAGTGTTGAACAATCCTCAAGCA       c.420
 V  D  F  S  Q  E  L  I  R  S  S  F  Q  V  L  N  N  P  Q  A         p.140

          .         .         .         .                           g.6254
 CAGCAAGGCTGCTCCTGTGGGTCATCTTTCTCTATCAAACTTTGA                      c.465
 Q  Q  G  C  S  C  G  S  S  F  S  I  K  L  X                        p.154

          .         .         .         .         .         .       g.6314
 tgtgatgactggtgactctgggattgtcaccagttgtaccaatttgaagaacctggaatt       c.*60

          .         .         .         .         .         .       g.6374
 agtagaattctagaagtttacttctaatcatgtccctctcaattttatttcccgcagtcc       c.*120

          .         .         .         .         .         .       g.6434
 aggagtgttatgttttgccactattattttcagaatgtgaagattttactcttggcttaa       c.*180

          .         .         .         .         .         .       g.6494
 tttttccctccactcagtgctaaggctgagcctccagatgctgttacctcagatttaatc       c.*240

          .         .         .         .         .         .       g.6554
 actggttgaaactccgtataatctgtagagcctccatggctctaaaatttggaattaact       c.*300

          .         .         .         .         .         .       g.6614
 tctcttgccttaagagctgcttgtacatatgtggatagctatgtataaaagcttcatttt       c.*360

          .         .         .         .         .         .       g.6674
 aaagaaggttcttattgtgttgtggatcagggtcacagattgggtagcttggacaccagt       c.*420

          .         .         .         .         .         .       g.6734
 tattagaggatgagaaaagtaaatgaaatgttctctttttcacttcaccctgccagaatg       c.*480

          .         .         .         .         .         .       g.6794
 tgccacttgacttatctttattgtctatgcaacccatttgccacttcctgtttgatagga       c.*540

          .         .                                               g.6822
 cagatacattttactctcatgctcgtgg                                       c.*568

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Iron-sulfur cluster assembly 2 homolog (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.