iron-sulfur cluster scaffold homolog (E. coli) (ISCU) - coding DNA reference sequence

(used for variant description)

(last modified December 30, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_014301.3 in the ISCU gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_011857.1, covering ISCU transcript NM_014301.3. Exon 02 is alternatively spliced in transcript variant 2  (NM_213595.2), resulting in an N-terminally different protein (ISCU2) found in the mitochondrion. Intron 5 contains an alternatively spliced exon 05b, present in a low prcentage of transcripts.

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5036
                         agcttcggtgacgtcagagaggcgcgctcccagctc       c.-241

 .         .         .         .         .         .                g.5096
 ggagccgactcgcagacgcgccccgcccctcggcgtcgctctggactggcgcaggcgcaa       c.-181

 .         .         .         .         .         .                g.5156
 gccggcaagatggcggcggctggggctttccgtctgaggcgggcggcatcggctctgctg       c.-121

 .         .         .         .         .         .                g.5216
 ctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaag       c.-61

 .   | 02     .         .         .         .         .             g.6599
 aag | gtatctcaaatctgtgaagtattgtagaggagacacaaaaggaattgggggtcacaa    c.-1

          .         .         .          | 03        .         .    g.6782
 ATGGTTCTCATTGACATGAGTGTAGACCTTTCTACTCAG | GTTGTTGATCATTATGAAAAT    c.60
 M  V  L  I  D  M  S  V  D  L  S  T  Q   | V  V  D  H  Y  E  N      p.20

          .         .         .         .         .         .       g.6842
 CCTAGAAACGTGGGGTCCCTTGACAAGACATCTAAAAATGTTGGAACTGGACTGGTGGGG       c.120
 P  R  N  V  G  S  L  D  K  T  S  K  N  V  G  T  G  L  V  G         p.40

          .         .         .    | 04    .         .         .    g.7830
 GCTCCAGCATGTGGTGACGTAATGAAATTACAG | ATTCAAGTGGATGAAAAGGGGAAGATT    c.180
 A  P  A  C  G  D  V  M  K  L  Q   | I  Q  V  D  E  K  G  K  I      p.60

          .         .         .         .         .         .       g.7890
 GTGGATGCTAGGTTTAAAACATTTGGCTGTGGTTCCGCAATTGCCTCCAGCTCATTAGCC       c.240
 V  D  A  R  F  K  T  F  G  C  G  S  A  I  A  S  S  S  L  A         p.80

          .         .     | 05   .         .         .         .    g.9708
 ACTGAATGGGTGAAAGGAAAGACG | GTGGAGGAAGCCTTGACTATCAAAAACACAGATATC    c.300
 T  E  W  V  K  G  K  T   | V  E  E  A  L  T  I  K  N  T  D  I      p.100

          .         .         .         .    | 06    .         .    g.11330
 GCCAAGGAGCTCTGCCTTCCTCCCGTGAAACTGCACTGCTCCA | TGCTGGCTGAAGATGCA    c.360
 A  K  E  L  C  L  P  P  V  K  L  H  C  S  M |   L  A  E  D  A      p.120

          .         .         .         .         .         .       g.11390
 ATCAAGGCCGCCCTGGCTGATTACAAATTGAAACAAGAACCCAAAAAAGGAGAGGCAGAG       c.420
 I  K  A  A  L  A  D  Y  K  L  K  Q  E  P  K  K  G  E  A  E         p.140

                                                                    g.11399
 AAGAAATGA                                                          c.429
 K  K  X                                                            p.142

          .         .         .         .         .         .       g.11459
 gccctccctcggcgaagcctccagcaggccacaccagctgtttcccacctgctgtgcagt       c.*60

          .         .         .         .         .         .       g.11519
 caccttagatgttcagaagccgcttcctctccactgaagagctatgagatacgcacaata       c.*120

          .         .         .         .         .         .       g.11579
 cttgctgttcacgttatgactctcatgcaagcaaaatacacagtttcattgttctgaatc       c.*180

          .         .         .         .         .         .       g.11639
 ctgtggtttctttcagcccacttttatcgccttaacctagttaatgtatattttgaattg       c.*240

          .         .         .         .         .         .       g.11699
 tgtgtatgacctcagaactgaaattgataatgaagttgcaagttttgatagcccgtgaag       c.*300

          .         .         .         .         .         .       g.11759
 tgcataagtatctaattttacctgaattgatttggggggaaattaccagtagaatgcctt       c.*360

          .         .         .         .         .         .       g.11819
 ggtctgaatatttgatagaaccaattgttgtacataaaacagattgcgcatatatatata       c.*420

          .         .         .         .                           g.11867
 tgtataaaaaataataaaataatggaagatgatggtgttctctagtaa                   c.*468

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Iron-sulfur cluster scaffold homolog (E. coli) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center