(used for variant description)
(last modified December 30, 2019)
This file was created to facilitate the description of sequence variants on transcript NM_014301.3 in the ISCU gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_011857.1, covering ISCU transcript NM_014301.3. Exon 02 is alternatively spliced in transcript variant 2 (NM_213595.2), resulting in an N-terminally different protein (ISCU2) found in the mitochondrion. Intron 5 contains an alternatively spliced exon 05b, present in a low prcentage of transcripts.
Please note that introns are available by clicking on the exon numbers above the sequence.(upstream sequence) . . . g.5036 agcttcggtgacgtcagagaggcgcgctcccagctc c.-241 . . . . . . g.5096 ggagccgactcgcagacgcgccccgcccctcggcgtcgctctggactggcgcaggcgcaa c.-181 . . . . . . g.5156 gccggcaagatggcggcggctggggctttccgtctgaggcgggcggcatcggctctgctg c.-121 . . . . . . g.5216 ctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaag c.-61 . | 02 . . . . . g.6599 aag | gtatctcaaatctgtgaagtattgtagaggagacacaaaaggaattgggggtcacaa c.-1 . . . | 03 . . g.6782 ATGGTTCTCATTGACATGAGTGTAGACCTTTCTACTCAG | GTTGTTGATCATTATGAAAAT c.60 M V L I D M S V D L S T Q | V V D H Y E N p.20 . . . . . . g.6842 CCTAGAAACGTGGGGTCCCTTGACAAGACATCTAAAAATGTTGGAACTGGACTGGTGGGG c.120 P R N V G S L D K T S K N V G T G L V G p.40 . . . | 04 . . . g.7830 GCTCCAGCATGTGGTGACGTAATGAAATTACAG | ATTCAAGTGGATGAAAAGGGGAAGATT c.180 A P A C G D V M K L Q | I Q V D E K G K I p.60 . . . . . . g.7890 GTGGATGCTAGGTTTAAAACATTTGGCTGTGGTTCCGCAATTGCCTCCAGCTCATTAGCC c.240 V D A R F K T F G C G S A I A S S S L A p.80 . . | 05 . . . . g.9708 ACTGAATGGGTGAAAGGAAAGACG | GTGGAGGAAGCCTTGACTATCAAAAACACAGATATC c.300 T E W V K G K T | V E E A L T I K N T D I p.100 . . . . | 06 . . g.11330 GCCAAGGAGCTCTGCCTTCCTCCCGTGAAACTGCACTGCTCCA | TGCTGGCTGAAGATGCA c.360 A K E L C L P P V K L H C S M | L A E D A p.120 . . . . . . g.11390 ATCAAGGCCGCCCTGGCTGATTACAAATTGAAACAAGAACCCAAAAAAGGAGAGGCAGAG c.420 I K A A L A D Y K L K Q E P K K G E A E p.140 g.11399 AAGAAATGA c.429 K K X p.142 . . . . . . g.11459 gccctccctcggcgaagcctccagcaggccacaccagctgtttcccacctgctgtgcagt c.*60 . . . . . . g.11519 caccttagatgttcagaagccgcttcctctccactgaagagctatgagatacgcacaata c.*120 . . . . . . g.11579 cttgctgttcacgttatgactctcatgcaagcaaaatacacagtttcattgttctgaatc c.*180 . . . . . . g.11639 ctgtggtttctttcagcccacttttatcgccttaacctagttaatgtatattttgaattg c.*240 . . . . . . g.11699 tgtgtatgacctcagaactgaaattgataatgaagttgcaagttttgatagcccgtgaag c.*300 . . . . . . g.11759 tgcataagtatctaattttacctgaattgatttggggggaaattaccagtagaatgcctt c.*360 . . . . . . g.11819 ggtctgaatatttgatagaaccaattgttgtacataaaacagattgcgcatatatatata c.*420 . . . . g.11867 tgtataaaaaataataaaataatggaagatgatggtgttctctagtaa c.*468 (downstream sequence)Legend:
Powered by LOVD
v.3.0 Build 22
©2004-2019 Leiden
University Medical Center