integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) (ITGB2) - 352 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.23174
gtgagttctgtgttccacggaggggactccacgcgtgacattccaatcagggagaacagg  c.58+60

         .         .         .         .         .         .  g.23234
gcctgccctcactttcccatagacagaagttcccgggaggctggggaaggaccttgccac  c.58+120

         .         .         .         .         .        g.23290
tgggggtaggtcggggactcaggcctcgtctccgcacgtgccaggaggctgtagct  c.58+176

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.23346
    gtgctgtttcccgagggcccctctttgcacctgggggtggtggcgaatgcggggtc  c.59-121

.         .         .         .         .         .           g.23406
tcctcctggaggctgcctccctgtctttttgggcctcctctgaccttcctgctctactcc  c.59-61

.         .         .         .         .         .           g.23466
cccttgggtgtgggcagggcggcccagagcacccactcaccagccggcctcgtccctcag  c.59-1


Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center