integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) (ITGB2) - 1157 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.33579
gtaagtccccaccccaggcacccaggcaccgcctggcaggacaccactgacggaggagac  c.897+60

         .         .         .         .         .         .  g.33639
aagggtggggtctccacctgacagagcctccttctgacccaaggagcagattcctgagga  c.897+120

         .         .         .         .         .         .  g.33699
aacttctggaagccccaagtggcagcgtggggtctccccggactggcctcaggccagggg  c.897+180

         .         .         .         .         .         .  g.33759
agggtagggttggtgggggcagccaggctgaggcccggcctcgcccttgtgggacaccca  c.897+240

         .         .         .         .         .         .  g.33819
ggctctgttggtctccagccccactgcccccctacctgggctgacagctgctgtggaggt  c.897+300

         .         .         .         .         .         .  g.33879
atagtaaccgcccccaggctacggctgcaccctgccgtccccgcctctggccagggtccc  c.897+360

         .         .         .         .         .         .  g.33939
atccccaagcatccgcctcctccccctcccggcctccactgtacgttccctgctgcccct  c.897+420

         .         .         .         .         .         .  g.33999
gagtccgcctcctccagtgtggcccctccctgcccccattgcctgagctgggtgagcggc  c.897+480

         .         .         .         .         .         .  g.34059
tgcggggaccatgaggaacatgcagggagggacagaggcgagaaggagcccaggatgcac  c.897+540

         .         .         .           g.34098
gggttaggatgagcctctctgcggaggcatctcaatggc  c.897+579

--------------------- middle of intron ---------------------
           g.34099            .         .         .           g.34136
           c.898-578  tcagaggggccaggacttctggctgggatcagccgtgg  c.898-541

.         .         .         .         .         .           g.34196
gccgagaggcaaccactggtcacaaggggcttgtcctcgctggccgtagtgcgacgctct  c.898-481

.         .         .         .         .         .           g.34256
tgcagcctgacgttgtaggctctgggggccgcaaaggactttagagatacaagactcagg  c.898-421

.         .         .         .         .         .           g.34316
tcctccgccgggagccacagacgggagggacggccctcgggtcccggaactcgggtaggg  c.898-361

.         .         .         .         .         .           g.34376
agagccgcacctgacactcatggcctctaccgaaactgagtgtccctcagtgcgaaagca  c.898-301

.         .         .         .         .         .           g.34436
ggtccaccgtgtggggaaggctgggattctgcccccgtggacatccccagtcccacggtg  c.898-241

.         .         .         .         .         .           g.34496
agacgcctcaaatgctgctcatgcctggactctgaaagcccgagtctatgcacacattgc  c.898-181

.         .         .         .         .         .           g.34556
ccagagggcgtggcagctctctgccctgcactcctgcgtggcagcctctgcctctccagc  c.898-121

.         .         .         .         .         .           g.34616
cttccccagagagggttcgaagcacgggcagggctgacgctgagcggggcagacaggggc  c.898-61

.         .         .         .         .         .           g.34676
gggtacctggaagccttgtcctggactcggggccaactgagcaggacctcctctctccag  c.898-1


Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center