integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) (ITGB2) - 1407 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)
         .         .         .         .         .         .  g.40495
gtgagcctggccacaagggtccccatcccagcttgctgaggggctctggggacagccaga  c.1224+60

         .         .         .         .         .         .  g.40555
aggagccagggtccccatcccagcacactgaggggtcctggggacagccagaaggagcca  c.1224+120

         .         .         .         .         .         .  g.40615
gggtccccatcccagcactctgacgggggcagggaggggcacacaggcatcagaggctgt  c.1224+180

         .         .         .         .         .         .  g.40675
ctgggagcaggcagcatccactggaaggaccctgtttctttccttcacatcctctctgcc  c.1224+240

         .         .         .         .         .         .  g.40735
gaggccagacgctttccttgtgaagctgatgtcaggaacgtcagtgagagggtgccgaga  c.1224+300

         .         .         .         .         .         .  g.40795
gggtgcttctcagtgagagggtgctgggagggttcttcacacacgccttggcccccaaga  c.1224+360

         .         .         .         .         .         .  g.40855
gtcctactcatcaacctggagcccaaatccctgggtcaggccactgcagactgagggatg  c.1224+420

         .         .         .         .         .         .  g.40915
gagtgatggctgcgccccctgggggcagacgccggacacacagaacaggcgcaaacggca  c.1224+480

         .         .         .         .         .         .  g.40975
aacctgggtagggttagttgtcatgattttctgcgtgtttcattctgtttttttgacaga  c.1224+540

         .         .         .         .         .         .  g.41035
aacattaaggcatgggccacacaggtggttaggaatggacactgagttccttctctaatc  c.1224+600

         .         .         .         .         .         .  g.41095
tttcaggtttaagtttattatccaatcatttgttgtttctttttgttttttgttttttgt  c.1224+660

         .         .         .         .      g.41139
ttttttttttgctagctgtgaaataatattcagcaagacacttg  c.1224+704

--------------------- middle of intron ---------------------
     g.41140        .         .         .         .           g.41182
     c.1225-703  ctttcattgcattttcttaatatgactttggaattccttcaaa  c.1225-661

.         .         .         .         .         .           g.41242
catgtttcttggtaaatgttgcctgtggatttttttttttttttttttttttgagatgga  c.1225-601

.         .         .         .         .         .           g.41302
gtttcgctctgtcgcccaggctggagtgcactggtgcgatcttggctcactacaatccaa  c.1225-541

.         .         .         .         .         .           g.41362
gtgattctcctgactcagcctcctgagtagctgggactacaggcgtgtgccaccacgctc  c.1225-481

.         .         .         .         .         .           g.41422
ggctaatttttgtatttttagtagagacagagtttcgccatgttggccaggctggtctca  c.1225-421

.         .         .         .         .         .           g.41482
aactcttgccctcagatgatctacccgcctcggcctcccacagtgctgggattacaggcg  c.1225-361

.         .         .         .         .         .           g.41542
tgagccgcggcgcccagctgtcccatggattctcaccagaacgtttccctcatgttgggt  c.1225-301

.         .         .         .         .         .           g.41602
ggtctgagtgggagtgtgctcagcttctcctgatttgctgtctgcgtgtcacatgtctct  c.1225-241

.         .         .         .         .         .           g.41662
gctgatgtgtggccggggagatcctggtgccggccagtgcgggagtgcgggcagagcacc  c.1225-181

.         .         .         .         .         .           g.41722
tccttgccggctgactttggctctcggatctgagcatcagctcttcctgctcctggtcac  c.1225-121

.         .         .         .         .         .           g.41782
cccttcctccccacgctgaaccccccaggacccctgcagaggccaggaggtgagggttgg  c.1225-61

.         .         .         .         .         .           g.41842
gagctgggctgccaccctggccaccgagggtccccacctgagcccagcactgccctgcag  c.1225-1