integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) (ITGB2) - 482 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.43921
gtgagcccgtgggtccctgctggacaacggccgtcctgcggcacagacttggtgttgggg  c.1657+60

         .         .         .         .         .         .  g.43981
ggtgcgttctggaccattcaacgagtggaacagaaaggggggatcctgaggacagacagt  c.1657+120

         .         .         .         .         .         .  g.44041
gcaagtctcgcccagccaccgggcgtcagcaggaacttggatggccctgcaccccgccct  c.1657+180

         .         .         .         .         .         .  g.44101
gcctcagtttctgtgtccatgaggacaaggcgtccttgtggggagggcccacaggaggaa  c.1657+240

   g.44102
c  c.1657+241

--------------------- middle of intron ---------------------
                                               g.44103        g.44103
                                               c.1658-241  g  c.1658-241

.         .         .         .         .         .           g.44163
gtcatagccctattgaggtcccattcacagcagggcaggggaggtccagactggccagga  c.1658-181

.         .         .         .         .         .           g.44223
ggcggccacgtggctggcgggggcagaagggcctggctagtggccccatgccttttgctc  c.1658-121

.         .         .         .         .         .           g.44283
aggaacatcccccaggctggaggaggcaggcgggccggagggagcaaccgcagtggggtt  c.1658-61

.         .         .         .         .         .           g.44343
tcgggcgggtctcggttcccaggccaagcaggagcttagccgtgctgccccgtcttccag  c.1658-1


Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center