integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) (ITGB2) - 380 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.44623
gtgagtgcaggcggagcaggcagggcgggcagggatccccactccccggccacctaccca  c.1877+60

         .         .         .         .         .         .  g.44683
gcagccgggctcactcggggaccccagtgagcacctctgcaccgcggggttctctgcggg  c.1877+120

         .         .         .         .         .         .  g.44743
tgcgtctggactgaggggccctccgcggccgccgtgcccctgtgtccctcctccctcctg  c.1877+180

         .  g.44753
tgcgcacctg  c.1877+190

--------------------- middle of intron ---------------------
                                      g.44754     .           g.44763
                                      c.1878-190  ccgcgggccc  c.1878-181

.         .         .         .         .         .           g.44823
tgggatcaggcttccagttcacccgctgcacccgcatctgccccacttgggccccctcct  c.1878-121

.         .         .         .         .         .           g.44883
tggcctgagggcgccccaaccccacctgccccccctggtggacacacacccaagcccgag  c.1878-61

.         .         .         .         .         .           g.44943
cccccgttgccggagcccccgcacaccctggcaccgatgctcacacctggctccccgcag  c.1878-1


Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center