junctional sarcoplasmic reticulum protein 1 (JSRP1) - coding DNA reference sequence

(used for mutation description)

(last modified July 18, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_144616.3 in the JSRP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032853.1, covering JSRP1 transcript NM_144616.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5011
                                                  tcctccgtcct       c.-61

 .         .         .          | 02        .         .             g.6109
 gtccacaaggctcagcaaagcggctggcgg | cctggcctgggacctgctgctgctccagcc    c.-1

          .         .         .         .         .         .       g.6169
 ATGTCCATGACAACCAGAGCCTGGGAGGAGCTGGATGGCGGCCTGGGCAGCTGCCAGGCC       c.60
 M  S  M  T  T  R  A  W  E  E  L  D  G  G  L  G  S  C  Q  A         p.20

          .         .         .         .          | 03        .    g.6952
 CTGGAGGACCACTCTGCGCTGGCCGAGACCCAGGAGGACAGGGCTTCAG | CGACACCCAGG    c.120
 L  E  D  H  S  A  L  A  E  T  Q  E  D  R  A  S  A |   T  P  R      p.40

          .         .        | 04.         .         .         .    g.7155
 CTGGCCGACTCCGGCAGCGTGCCCCAC | GACTCTCAGGTGGCTGAAGGCCCCAGTGTGGAC    c.180
 L  A  D  S  G  S  V  P  H   | D  S  Q  V  A  E  G  P  S  V  D      p.60

          .         .         .         .         .         .       g.7215
 ACCAGGCCCAAGAAGATGGAAAAAGAGCCTGCCGCCAGGGGGACCCCAGGAACGGGGAAG       c.240
 T  R  P  K  K  M  E  K  E  P  A  A  R  G  T  P  G  T  G  K         p.80

          .         .   | 05     .         .         .         .    g.7668
 GAGAGGCTGAAAGCCGGAGCGA | GCCCTCGGAGCGTCCCCGCGCGCAAGAAGGCGCAGACC    c.300
 E  R  L  K  A  G  A  S |   P  R  S  V  P  A  R  K  K  A  Q  T      p.100

          .         .         .         .         .         .       g.7728
 GCGCCGCCCCTGCAGCCGCCGCCGCCGCCCCCGGCCCTGAGCGAGGAGCTGCCCTGGGGA       c.360
 A  P  P  L  Q  P  P  P  P  P  P  A  L  S  E  E  L  P  W  G         p.120

          .         .         .         .         .         .       g.7788
 GACCTGTCGCTCAACAAGTGCCTGGTGCTCGCCTCGCTGGTGGCGCTGCTGGGCTCGGCT       c.420
 D  L  S  L  N  K  C  L  V  L  A  S  L  V  A  L  L  G  S  A         p.140

          .       | 06 .         .         .         .         .    g.8464
 TTCCAGCTGTGCCGCG | ACGCCGTCCCTGGGGAGGCAGCACTCCAAGCACGTGTGCCCGAG    c.480
 F  Q  L  C  R  D |   A  V  P  G  E  A  A  L  Q  A  R  V  P  E      p.160

          .         .         .         .         | 07         .    g.8639
 CCCTGGGTCCCGCCAAGCTCAGCCCCGAGGGAGCCATCGTCGCCCCTG | CCTAAGTTCGAG    c.540
 P  W  V  P  P  S  S  A  P  R  E  P  S  S  P  L   | P  K  F  E      p.180

          .         .         .         .         .         .       g.8699
 GCCCAGGCGCCTCCATCAGCGCCGCCTGCGCCCCGGGCCGAGGCAGAGGTCAGACCCAAG       c.600
 A  Q  A  P  P  S  A  P  P  A  P  R  A  E  A  E  V  R  P  K         p.200

          .         .         .         .         .         .       g.8759
 ATTCCCGGGAGTCGGGAGGCTGCAGAGAACGACGAAGAGGAGCCCGGCGAGGCCACCGGA       c.660
 I  P  G  S  R  E  A  A  E  N  D  E  E  E  P  G  E  A  T  G         p.220

          .         .         .         .         .         .       g.8819
 GAGGCCGTCCGGGAGGACCGTGTGACCCTCGCAGACCGGGGACCCAAGGAGAGGCCTCGG       c.720
 E  A  V  R  E  D  R  V  T  L  A  D  R  G  P  K  E  R  P  R         p.240

          .         .         .         .         .         .       g.8879
 AGAGAGGGGAAGCCGCGGAAGGAGAAGCCGCGGAAGGAGGAGAGACCTAAGAAAGAGAGG       c.780
 R  E  G  K  P  R  K  E  K  P  R  K  E  E  R  P  K  K  E  R         p.260

          .         .         .         .         .         .       g.8939
 CCGCGGAAAGAGGAGAGGCCACGGGCCGCCAGGGAGCCCCGGGAAGCCCTACCCCAGCGC       c.840
 P  R  K  E  E  R  P  R  A  A  R  E  P  R  E  A  L  P  Q  R         p.280

          .         .         .         .         .         .       g.8999
 TGGGAGTCACGCGAAGGGGGCCACCGGCCGTGGGCACGGGACTCCAGGGACGCCGAGCCC       c.900
 W  E  S  R  E  G  G  H  R  P  W  A  R  D  S  R  D  A  E  P         p.300

          .         .         .         .         .         .       g.9059
 AGGAAGAAGCAGGCCTGGGTGTCCCCGAGGCGTCCCGACGAGGAGCAGCGGCCTGGGAGT       c.960
 R  K  K  Q  A  W  V  S  P  R  R  P  D  E  E  Q  R  P  G  S         p.320

          .         .         .                                     g.9095
 CGCCAGAAGCTCCGCGCAGGCAAGGGGCGGGACTGA                               c.996
 R  Q  K  L  R  A  G  K  G  R  D  X                                 p.331

          .         .         .         .         .         .       g.9155
 gccggccccgcgccggagtccaggggccccttctggacgccccgcgactctggcgaaata       c.*60

          .                                                         g.9173
 aagcgagtgctgcggccg                                                 c.*78

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Junctional sarcoplasmic reticulum protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-06
©2004-2012 Leiden University Medical Center