potassium voltage-gated channel, Isk-related family, member 1 (KCNE1) - coding DNA reference sequence

(used for variant description)

(last modified June 6, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_000219.4 in the KCNE1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000021.8, covering KCNE1 transcript NM_000219.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5025
                                    gaaatcacaaattacaaaacgtcag       c.-601

 .         .         .         .         .         .                g.5085
 agtactttctggaaataagccttcctctccagggaacaacgcatttgacacttgactggg       c.-541

 .         .         .         .         .         .                g.5145
 atacactaccggatcctccgagggtgatggttctcaagaaggcagaagcaatggtgacca       c.-481

 .         .         .         .         .         .                g.5205
 atagacctccttaaaggctgagccgctgggcaccttcctactcctctcgaccgtgctagg       c.-421

 .         .         .         .         .    | 02    .             g.5976
 atgactgcagcagagtccccgagtcctttgatgcaagggtctag | caaccaccaaacagac    c.-361

 .         .         .         .         .         .                g.6036
 aagcccttcggcctgtcctggagggcgttgaatggcatggcctggagctcaaccaggaga       c.-301

 .         .         .         .         .         .                g.6096
 accgtgctcaggaggaagagaccagaaggataactcaaaaagttctgagaagttcctaag       c.-241

 .         .         .         .         .         .                g.6156
 accacctgaagagaaggagcctgctgccaatggtgtggacaccgcagtgtgcttgaggag       c.-181

 .         .         | 03         .         .         .             g.58552
 acttcagaaacgagaactg | gaaaaatccctctgctttctctggccagtttcacacaatca    c.-121

 .         .         .         .         .         .                g.58612
 tcaggtgagccgaggatccattggaggaaggcattatctgtatccagaggaaatagccaa       c.-61

 .          | 04        .         .         .         .             g.67641
 ggatattcag | aggtgtgcctgggaagtttgagctgcagcagtggaaccttaatgcccagg    c.-1

          .         .         .         .         .         .       g.67701
 ATGATCCTGTCTAACACCACAGCGGTGACGCCCTTTCTGACCAAGCTGTGGCAGGAGACA       c.60
 M  I  L  S  N  T  T  A  V  T  P  F  L  T  K  L  W  Q  E  T         p.20

          .         .         .         .         .         .       g.67761
 GTTCAGCAGGGTGGCAACATGTCGGGCCTGGCCCGCAGGTCCCCCCGCAGCAGTGACGGC       c.120
 V  Q  Q  G  G  N  M  S  G  L  A  R  R  S  P  R  S  S  D  G         p.40

          .         .         .         .         .         .       g.67821
 AAGCTGGAGGCCCTCTACGTCCTCATGGTACTGGGATTCTTCGGCTTCTTCACCCTGGGC       c.180
 K  L  E  A  L  Y  V  L  M  V  L  G  F  F  G  F  F  T  L  G         p.60

          .         .         .         .         .         .       g.67881
 ATCATGCTGAGCTACATCCGCTCCAAGAAGCTGGAGCACTCGAACGACCCATTCAACGTC       c.240
 I  M  L  S  Y  I  R  S  K  K  L  E  H  S  N  D  P  F  N  V         p.80

          .         .         .         .         .         .       g.67941
 TACATCGAGTCCGATGCCTGGCAAGAGAAGGACAAGGCCTATGTCCAGGCCCGGGTCCTG       c.300
 Y  I  E  S  D  A  W  Q  E  K  D  K  A  Y  V  Q  A  R  V  L         p.100

          .         .         .         .         .         .       g.68001
 GAGAGCTACAGGTCGTGCTATGTCGTTGAAAACCATCTGGCCATAGAACAACCCAACACA       c.360
 E  S  Y  R  S  C  Y  V  V  E  N  H  L  A  I  E  Q  P  N  T         p.120

          .         .         .                                     g.68031
 CACCTTCCTGAGACGAAGCCTTCCCCATGA                                     c.390
 H  L  P  E  T  K  P  S  P  X                                       p.129

          .         .         .         .         .         .       g.68091
 accccaccactggctaaaactggacacatcctgcctggcaacctgattttctaatcacat       c.*60

          .         .         .         .         .         .       g.68151
 tcctctcatactctttattgtgatggataccactggatttctttttggctgttgtaaggg       c.*120

          .         .         .         .         .         .       g.68211
 gtgaggggtggattaatgacactgtttcactgtttctctaaaatcacgttcttttgtgat       c.*180

          .         .         .         .         .         .       g.68271
 agactgtcagtggttcccccatatctgtccctgccttgctaaatttagcagaatccctga       c.*240

          .         .         .         .         .         .       g.68331
 ggacatggcctctgagaatagcagctgcatttcccagactcccttgcagctagcaaggtt       c.*300

          .         .         .         .         .         .       g.68391
 gtgtgactaagccctggccagtaggcatggaagtgaagactgtaatgtccaagtaatcct       c.*360

          .         .         .         .         .         .       g.68451
 tggaaagaaaagaacgtgcccttaactaactttgtcctgcttcccagtggctggatgtgg       c.*420

          .         .         .         .         .         .       g.68511
 aggaggtggagagcagttatgagactgggaaagaacggggcactcaaagagccacacaca       c.*480

          .         .         .         .         .         .       g.68571
 tctgggcctgggcgacgtggatcctccttaccacccaccaggccagatttacaggagaga       c.*540

          .         .         .         .         .         .       g.68631
 gaaatccactccactcttccttaagccactgttattctgatctctgttaaggtcgcagaa       c.*600

          .         .         .         .         .         .       g.68691
 tcaatgcccttactgatacacctaccttataggactgaacctaaaggcatgacatttcca       c.*660

          .         .         .         .         .         .       g.68751
 tacttgtcacaagcacacactgattctgcccttgtcacttctgtgctcactcttgtggct       c.*720

          .         .         .         .         .         .       g.68811
 ctatcctcctcctgcccttccgccttccactcctcccttgcacccatcctgcacacatct       c.*780

          .         .         .         .         .         .       g.68871
 ccctgaaaacacacaggcacatacactcatatacatagacacacatacacacctcaatct       c.*840

          .         .         .         .         .         .       g.68931
 agaaagaacttgctttgtacagggctgagatggaggagaaaaaaatgcccccttcagaat       c.*900

          .         .         .         .         .         .       g.68991
 gcataccaaggggaaggtgctcggtcactgtgggagcagggaaaggtgcccccactcccc       c.*960

          .         .         .         .         .         .       g.69051
 gagagccaggggaaggagtggctctgggcagagagggacacatagcactggggtggcagg       c.*1020

          .         .         .         .         .         .       g.69111
 tccttttgaggtgatgggccggttttgtgagatgaattgtatcccccaaaaagacaggta       c.*1080

          .         .         .         .         .         .       g.69171
 ccttcaatgtgacctaattgggaaatagagtctttgcagatgatctagttgagatgaggt       c.*1140

          .         .         .         .         .         .       g.69231
 cattggggtgggccctcacccaatatgactggagtccttatcggaagagggaaattcaga       c.*1200

          .         .         .         .         .         .       g.69291
 cacagatgcatagggaggacaccatgccgtgacagaggcagagggtgcagtgacacagcc       c.*1260

          .         .         .         .         .         .       g.69351
 acaaaccaaggaaggccgaggatggatgcgcatccccatcccaagaagtcgggaagaagc       c.*1320

          .         .         .         .         .         .       g.69411
 caggaaggctcctctcccacaggtttcagaggaagcacagccctgcttgaattcaaactt       c.*1380

          .         .         .         .         .         .       g.69471
 ttggcctccagaactgtgagtcagtacctgttgttgaagccacccagcttaggatactct       c.*1440

          .         .         .         .         .         .       g.69531
 ggcagcctactgccatacagtattgggatactatagtgagcccatgcagcacctctcacc       c.*1500

          .         .         .         .         .         .       g.69591
 cacccagagatggagctgctctgccttccagcggggcacccggagggctgccccagcaga       c.*1560

          .         .         .         .         .         .       g.69651
 tagagagggcctccgttctgccacctgccttgaaagggtctccagctgccatatgtagca       c.*1620

          .         .         .         .         .         .       g.69711
 ttggagtcctctgcaatgcgacatcctgaaagctcagctgcctgggcattcctgaagagt       c.*1680

          .         .         .         .         .         .       g.69771
 atggaatatttaaatgaaacatatttttttaaaacctgcgcataagataaaagcagcccg       c.*1740

          .         .         .         .         .         .       g.69831
 tgtgcatcttgggccatcctcaaatggacagacttggtcttgtgaggttccagtccttgt       c.*1800

          .         .         .         .         .         .       g.69891
 ttcacataataaacactggcatggctcagcccctgagttaccacagtccttgagatgagt       c.*1860

          .         .         .         .         .         .       g.69951
 ggttctttgggttacaaagtcctctgaaagtctagtgagagctgtgatctttgccccacc       c.*1920

          .         .         .         .         .         .       g.70011
 cgaataatgcatatggacaccacaccttgcctgccgtgtccaggattcatgaccagtagc       c.*1980

          .         .         .         .         .         .       g.70071
 agcccagctatgcctgccacgtctcatggcccctgtgtaagccagacccttcttaggcag       c.*2040

          .         .         .         .         .         .       g.70131
 ttgcatattcccagactgaggcagggcaggtttgcagagagagacccagagtgcacgtga       c.*2100

          .         .         .         .         .         .       g.70191
 cccgcagtgtgatccctggcacgcactgactttgatattccaggcacacggactggctat       c.*2160

          .         .         .         .         .         .       g.70251
 ttatcaccacttctttttccccactaagattcctgtgccttttaaggcagagggagatcc       c.*2220

          .         .         .         .         .         .       g.70311
 ctatggcgttagtcttcccaggccttaaagggcccttgtcttcactcacaaacctcttat       c.*2280

          .         .         .         .         .         .       g.70371
 ctcttcttctccttcctctacattttaaagggggagagggaaaagtaaccgggagacaaa       c.*2340

          .         .         .         .         .         .       g.70431
 ttgagccacatattttcagacacttgttaccatattttaaaatctggcttcacatacaca       c.*2400

          .         .         .         .         .         .       g.70491
 gagtctttgctatgcaccatgtactgttctaagcttcttaaaaatagaatctcaattatt       c.*2460

          .         .         .         .         .         .       g.70551
 attttgcaggcaatactctatgcattcattagctaggacaacaatgcatttgcagtagtg       c.*2520

          .         .         .                                     g.70588
 agatttcgctaaaaaattaaagccatttactatgatc                              c.*2557

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Potassium voltage-gated channel, Isk-related family, member 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.