potassium voltage-gated channel, Isk-related family, member 2 (KCNE2) - coding DNA reference sequence

(used for variant description)

(last modified June 11, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_172201.1 in the KCNE2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008804.1, covering KCNE2 transcript NM_172201.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5020
                                         gtaaggtgaaggtgcccagc       c.-121

 .         .         .         .         .         .                g.5080
 aggctgaggcttgtgtgcaacccagaagagagctcgctaacgccagcaagaaggttcaga       c.-61

 .         .         .         .         .        | 02.             g.11455
 acagcctggctttggaaaggaatttcatcctgcccacacactgcatag | caggagggaagc    c.-1

          .         .         .         .         .         .       g.11515
 ATGTCTACTTTATCCAATTTCACACAGACGCTGGAAGACGTCTTCCGAAGGATTTTTATT       c.60
 M  S  T  L  S  N  F  T  Q  T  L  E  D  V  F  R  R  I  F  I         p.20

          .         .         .         .         .         .       g.11575
 ACTTATATGGACAATTGGCGCCAGAACACAACAGCTGAGCAAGAGGCCCTCCAAGCCAAA       c.120
 T  Y  M  D  N  W  R  Q  N  T  T  A  E  Q  E  A  L  Q  A  K         p.40

          .         .         .         .         .         .       g.11635
 GTTGATGCTGAGAACTTCTACTATGTCATCCTGTACCTCATGGTGATGATTGGAATGTTC       c.180
 V  D  A  E  N  F  Y  Y  V  I  L  Y  L  M  V  M  I  G  M  F         p.60

          .         .         .         .         .         .       g.11695
 TCTTTCATCATCGTGGCCATCCTGGTGAGCACTGTGAAATCCAAGAGACGGGAACACTCC       c.240
 S  F  I  I  V  A  I  L  V  S  T  V  K  S  K  R  R  E  H  S         p.80

          .         .         .         .         .         .       g.11755
 AATGACCCCTACCACCAGTACATTGTAGAGGACTGGCAGGAAAAGTACAAGAGCCAAATC       c.300
 N  D  P  Y  H  Q  Y  I  V  E  D  W  Q  E  K  Y  K  S  Q  I         p.100

          .         .         .         .         .         .       g.11815
 TTGAATCTAGAAGAATCGAAGGCCACCATCCATGAGAACATTGGTGCGGCTGGGTTCAAA       c.360
 L  N  L  E  E  S  K  A  T  I  H  E  N  I  G  A  A  G  F  K         p.120

          .                                                         g.11827
 ATGTCCCCCTGA                                                       c.372
 M  S  P  X                                                         p.123

          .         .         .         .         .         .       g.11887
 taagggagaaaggcaccaagctaacatctgacgtccagacatgaagagatgccagtgcca       c.*60

          .         .         .         .         .         .       g.11947
 cgaggcaaatccaaattgtctttgcttagaagaaagtgagttccttgctctctgttgaga       c.*120

          .         .         .         .         .         .       g.12007
 attttcatggagattatgtggttggccaataaagatagatgacatttcaatctcagtgat       c.*180

          .         .         .         .         .         .       g.12067
 ttatgcttgcttgttggagcaatattttgtgctgaagacctcttttactttccgggcaag       c.*240

          .         .         .         .         .                 g.12118
 tgaatgtcattttaatcaatatcaatgatgaaaataaagccaaatttgaag                c.*291

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Potassium voltage-gated channel, Isk-related family, member 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.