KDEL endoplasmic reticulum protein retention receptor 2 (KDELR2) - coding DNA reference sequence

(used for variant description)

(last modified May 16, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_001100603.1 in the KDELR2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering KDELR2 transcript NM_001100603.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5041
                    agggtgccccgcgcgcgcgcgcgccggcagttcggccacgt       c.-121

 .         .         .         .         .         .                g.5101
 ccctggccacgtcgcgggcgatctcgccatcttcgccgcttcctctcaggggccgccgcc       c.-61

 .         .         .         .         .         .                g.5161
 tcctgagccgcccagccccggggccgccgcgctgcgccgaccgccaccgccgccgccgcc       c.-1

          .         .         .         .         .         .       g.5221
 ATGAACATTTTCCGGCTGACTGGGGACCTGTCCCACCTGGCGGCCATCGTCATCCTGCTG       c.60
 M  N  I  F  R  L  T  G  D  L  S  H  L  A  A  I  V  I  L  L         p.20

          .         .         .  | 02      .         .         .    g.14963
 CTGAAGATCTGGAAGACGCGCTCCTGCGCCG | GTATTTCTGGGAAAAGCCAGCTTCTGTTT    c.120
 L  K  I  W  K  T  R  S  C  A  G |   I  S  G  K  S  Q  L  L  F      p.40

          .         .         .         .         .         .       g.15023
 GCACTGGTCTTCACAACTCGTTACCTGGATCTTTTTACTTCATTTATTTCATTGTATAAC       c.180
 A  L  V  F  T  T  R  Y  L  D  L  F  T  S  F  I  S  L  Y  N         p.60

          .   | 03     .         .         .         .         .    g.19512
 ACATCTATGAAG | GTTATCTACCTTGCCTGCTCCTATGCCACAGTGTACCTGATCTACCTG    c.240
 T  S  M  K   | V  I  Y  L  A  C  S  Y  A  T  V  Y  L  I  Y  L      p.80

          .         .         .         .         .         .       g.19572
 AAATTTAAGGCAACCTACGATGGAAATCATGATACCTTCCGAGTGGAGTTTCTGGTGGTC       c.300
 K  F  K  A  T  Y  D  G  N  H  D  T  F  R  V  E  F  L  V  V         p.100

          .         .         .         .         .  | 04      .    g.26052
 CCTGTGGGAGGCCTCTCATTTTTAGTTAATCACGATTTCTCTCCTCTTGAG | TACTCAAGG    c.360
 P  V  G  G  L  S  F  L  V  N  H  D  F  S  P  L  E   | Y  S  R      p.120

          .         .         .         .         .         .       g.26112
 GAAAGAAGCTCAGTTTGCCAGCATAAGTGCCAAAGACCATCACCAGCATCTGTCCTTCAG       c.420
 E  R  S  S  V  C  Q  H  K  C  Q  R  P  S  P  A  S  V  L  Q         p.140

          .         .         .         .         .         .       g.26172
 GGTGCTCGGACAGAATTCTTACCACAGCAAAGGCATAAGATGCTTGATACGGAAAATCAG       c.480
 G  A  R  T  E  F  L  P  Q  Q  R  H  K  M  L  D  T  E  N  Q         p.160

          .         .         .         .         .         .       g.26232
 AAACTTAACTCTTTTGTTGCAGATAGTCATCAGTGGCTCTGTAAAAACGCAGAGGAAAAG       c.540
 K  L  N  S  F  V  A  D  S  H  Q  W  L  C  K  N  A  E  E  K         p.180

          .         .                                               g.26253
 AGCCAGAAGGTTTCTGTTTAA                                              c.561
 S  Q  K  V  S  V  X                                                p.186

          .         .         .         .         .         .       g.26313
 tgcatcttgccttatctttttttattactgtgtacaaagatttttttacacaaagaaact       c.*60

          .         .         .         .         .         .       g.26373
 taatgctgtattaataaattcagtgtgtagcttcaattgggatagttccaaaagtgaaga       c.*120

          .         .         .         .         .         .       g.26433
 ttttgtgaggaataagtgcaaattttttttttattttaaaaaattctttgaaactcttaa       c.*180

          .         .         .         .         .         .       g.26493
 gtctttgtgtctgcaatgaaattgtactccttgacagttgatagattatatattcttcca       c.*240

          .         .         .         .         .         .       g.26553
 tccctcaaacttgcattccactatatttattttttggcaaaagatgagctgtatttgttt       c.*300

          .         .         .         .         .         .       g.26613
 gaaatctgagacactatgttcaattggatgtatctgttcaaatttattcccacgtgacgt       c.*360

          .         .         .         .         .         .       g.26673
 ggaagtccttcgttggatgtcacaacactacatttaaggttggtaaggatgacttggagg       c.*420

          .         .         .         .         .         .       g.26733
 tccatggttttcattaccaacattttaagattctgaatgtcgatggagtctcactgaaga       c.*480

          .         .         .         .         .         .       g.26793
 gtcaccaaaggtgcctgccctcctcccctgctgggaagtgtcagttggagactgtcccaa       c.*540

          .         .         .         .         .         .       g.26853
 gggtgctgaagaatccagtggcaggggttctggctgctttccatctgagtgtgggatggg       c.*600

          .         .         .         .         .         .       g.26913
 aggggtgttcatgatcatttggatatagcaatctactctgagaaatggaacacaaggagt       c.*660

          .         .         .         .         .         .       g.26973
 tacctatcactttcacttataattccaaaagatgactacaaccatgtccatgctcagatt       c.*720

          .         .         .         .         .         .       g.27033
 caaacagttttccatatcacttttgggtggtaagatgatttaattacagtttttttttta       c.*780

          .         .         .         .         .         .       g.27093
 attggcagcaccactaaccattccttacattcttttttgtatgtgtggttttctttttat       c.*840

          .         .         .         .         .         .       g.27153
 ttaacccgcagccgacatcgtagtttcttgttttgttttgttttacagagctgttgcatg       c.*900

          .         .         .         .         .         .       g.27213
 acttatgttaccatcctaaaaaacactatattaaacatggaataaattgtctttttatga       c.*960

          .         .         .         .         .         .       g.27273
 attaggctttttgaacatcctgtgttgggatttttttgtttttcaattggcaacaaaagc       c.*1020

          .         .         .         .         .         .       g.27333
 tctgtagggctgcagacatttaaagttcacataatcatctgtaagacattatgtattttg       c.*1080

          .         .         .         .         .         .       g.27393
 tggaaatactagaatttttttcctgattttgccattatatggatttgctattttttgatt       c.*1140

          .         .         .         .         .         .       g.27453
 aatgcaaaagtatatgactttgttttttatgtgatacaccataaatattaaagtgttgaa       c.*1200

          .         .         .         .         .         .       g.27513
 tactaacagtgctgactacaagaaggatgtagtattttggctttctgcattacaacgtct       c.*1260

          .         .         .         .         .         .       g.27573
 tctggaggaagggagcaggatgggtttcatttgtatctagtgtgtgtcttaacatctttc       c.*1320

          .         .         .         .         .         .       g.27633
 taaatcggcagtgtaactgcatagtttaacttcctgtctgtctccctcattttactcttc       c.*1380

          .         .         .         .         .         .       g.27693
 cctccttgtcttatgttttggcttttgtgtatcagagcatctttctttgcagcatcctag       c.*1440

          .         .         .         .         .         .       g.27753
 tcttgcttcagtttctgtggtctcttttcatcctgcttgaagattcggagtgtggaagga       c.*1500

          .         .         .         .         .         .       g.27813
 ggctaggaagtctggtgcagtaggtgagcagacctcttgctgcccagcccagggtgggtg       c.*1560

          .         .         .         .         .         .       g.27873
 gggcgcacacctgtctttgtgcatgcaaatctgatacacctggcgcatcctctggagagc       c.*1620

          .         .         .         .         .         .       g.27933
 acaacgcatggaaaggtctggaagctctgtgtagccattccttctgcagtcatcctaccc       c.*1680

          .         .         .         .         .         .       g.27993
 aagtaaaagtaaccttggctatgttaccaccgttttggtcacccaggaggacatcttagc       c.*1740

          .         .         .         .         .         .       g.28053
 aagggtgcctgcgagggagtgtgggactgggcctcatcctcgccggcgttggaaaccaag       c.*1800

          .         .         .         .         .         .       g.28113
 gccttgtatgccacgccttatgaagcactgtttcacagttactttcacttcccgaataaa       c.*1860

          .         .                                               g.28138
 ggttaccaggtaattaatattttta                                          c.*1885

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The KDEL endoplasmic reticulum protein retention receptor 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.