lysine (K)-specific demethylase 5C (KDM5C) - coding DNA reference sequence

(used for variant description)

(last modified June 8, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_004187.3 in the KDM5C gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering KDM5C transcript NM_004187.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5053
        cttgttcctccgccgttgcaatgaactattttctctcagtccggggtggtact       c.-481

 .         .         .         .         .         .                g.5113
 tttgagtaaccccttccaaatagaaacccataccagcctatttagctcggtctccactat       c.-421

 .         .         .         .         .         .                g.5173
 atgaaggtttcctagggcttggtgtgacgcaacgtatacgaggctcggaaggacaccccg       c.-361

 .         .         .         .         .         .                g.5233
 cggaaggatccggtttgttgtggtgtggggaggggagacgctgacaaaccaagatggcgg       c.-301

 .         .         .         .         .         .                g.5293
 cggcggcgctgaaggccgcggcgtttgggaggtaactgtggtggcgaaggctgcggtagt       c.-241

 .         .         .         .         .         .                g.5353
 ggggaggcaaccacacagtttggaagaaacggagcgggacgaagaggcggtagcagtaga       c.-181

 .         .         .         .         .         .                g.5413
 gtcagcctgagactctcagagcacgacggccacacgcccccttaggccctcggcgggcgg       c.-121

 .         .         .         .         .         .                g.5473
 cggctgccccgcttagggcctagcctccgagcattgcctcggcttcaaacagcggcggcg       c.-61

 .         .         .         .         .         .                g.5533
 ccatgagtccttaagggcggtccaagcctcccgatccctggcccagacctcgggcccacc       c.-1

          .         .         .         .         .         .       g.5593
 ATGGAGCCGGGGTCCGACGATTTCCTACCGCCACCGGAGTGCCCGGTGTTCGAGCCTAGC       c.60
 M  E  P  G  S  D  D  F  L  P  P  P  E  C  P  V  F  E  P  S         p.20

          .         .         .         .         .         .       g.5653
 TGGGCCGAGTTCCGAGACCCTCTTGGCTACATCGCGAAAATCAGGCCCATCGCAGAGAAA       c.120
 W  A  E  F  R  D  P  L  G  Y  I  A  K  I  R  P  I  A  E  K         p.40

          .         .         . | 02       .         .         .    g.9536
 TCGGGCATTTGCAAGATCCGCCCACCCGCG | GACTGGCAGCCACCCTTTGCTGTGGAAGTG    c.180
 S  G  I  C  K  I  R  P  P  A   | D  W  Q  P  P  F  A  V  E  V      p.60

          .         .         .         .         | 03         .    g.12036
 GACAACTTCAGGTTTACCCCCCGAATCCAGAGGCTGAATGAGCTAGAG | GCCCAGACGAGA    c.240
 D  N  F  R  F  T  P  R  I  Q  R  L  N  E  L  E   | A  Q  T  R      p.80

          .         .         .         .         .         .       g.12096
 GTGAAACTGAACTACTTGGACCAGATTGCCAAATTCTGGGAAATCCAGGGCTCCTCCTTA       c.300
 V  K  L  N  Y  L  D  Q  I  A  K  F  W  E  I  Q  G  S  S  L         p.100

          .         .         .         .         .  | 04      .    g.12465
 AAGATTCCCAATGTAGAACGGCGGATCTTGGACCTCTACAGTCTCAGCAAA | ATTGTGGTG    c.360
 K  I  P  N  V  E  R  R  I  L  D  L  Y  S  L  S  K   | I  V  V      p.120

          .         .         .         .         .         .       g.12525
 GAGGAAGGTGGTTATGAAGCTATCTGCAAGGACCGTCGGTGGGCTCGGGTAGCCCAGCGC       c.420
 E  E  G  G  Y  E  A  I  C  K  D  R  R  W  A  R  V  A  Q  R         p.140

          .         .         .         .         .         .       g.12585
 CTCAACTATCCACCAGGCAAAAATATTGGCTCCTTGCTACGCTCCCACTACGAACGCATT       c.480
 L  N  Y  P  P  G  K  N  I  G  S  L  L  R  S  H  Y  E  R  I         p.160

          .         .         .         .   | 05     .         .    g.13163
 GTTTATCCCTATGAAATGTACCAGTCTGGAGCCAACCTTGTG | CAGTGTAACACACGTCCA    c.540
 V  Y  P  Y  E  M  Y  Q  S  G  A  N  L  V   | Q  C  N  T  R  P      p.180

          .         .         .         .         .         .       g.13223
 TTTGATAATGAGGAGAAGGACAAGGAATACAAACCCCACAGCATCCCCCTACGACAGTCT       c.600
 F  D  N  E  E  K  D  K  E  Y  K  P  H  S  I  P  L  R  Q  S         p.200

          .         .         .         .         .        | 06.    g.14228
 GTGCAGCCTTCCAAGTTCAACAGCTATGGCCGGCGGGCCAAGAGACTGCAGCCTGAT | CCG    c.660
 V  Q  P  S  K  F  N  S  Y  G  R  R  A  K  R  L  Q  P  D   | P      p.220

          .         .         .         .         .         .       g.14288
 GAACCCACAGAGGAAGACATTGAGAAGAATCCAGAGCTGAAAAAGCTACAGATCTATGGG       c.720
 E  P  T  E  E  D  I  E  K  N  P  E  L  K  K  L  Q  I  Y  G         p.240

          .         .         .         .         .         .       g.14348
 GCAGGCCCCAAGATGATGGGCCTGGGCCTCATGGCCAAAGACAAGACTCTGCGGAAGAAA       c.780
 A  G  P  K  M  M  G  L  G  L  M  A  K  D  K  T  L  R  K  K         p.260

   | 07      .         .         .         .         .         .    g.14505
 G | ATAAGGAGGGGCCTGAGTGTCCCCCCACAGTAGTGGTGAAGGAGGAGTTAGGTGGGGAT    c.840
 D |   K  E  G  P  E  C  P  P  T  V  V  V  K  E  E  L  G  G  D      p.280

          .         .         .         .         .         .       g.14565
 GTGAAGGTGGAGTCAACATCGCCTAAGACCTTCCTGGAGAGCAAGGAGGAGCTGAGTCAC       c.900
 V  K  V  E  S  T  S  P  K  T  F  L  E  S  K  E  E  L  S  H         p.300

          .         .         .         .         .         .       g.14625
 AGCCCAGAACCCTGCACCAAGATGACCATGAGGCTACGGAGGAACCACAGCAATGCCCAG       c.960
 S  P  E  P  C  T  K  M  T  M  R  L  R  R  N  H  S  N  A  Q         p.320

     | 08    .         .         .         .         .         .    g.15632
 TTT | ATTGAGTCATATGTCTGCCGGATGTGTTCTCGAGGGGATGAGGATGACAAGCTCCTG    c.1020
 F   | I  E  S  Y  V  C  R  M  C  S  R  G  D  E  D  D  K  L  L      p.340

          .         .         .         .         .         .       g.15692
 CTGTGTGATGGCTGTGATGACAACTACCACATCTTCTGCCTGCTGCCTCCTCTGCCTGAG       c.1080
 L  C  D  G  C  D  D  N  Y  H  I  F  C  L  L  P  P  L  P  E         p.360

          .         .         .         .   | 09     .         .    g.18534
 ATCCCCAAGGGTGTCTGGCGGTGCCCAAAGTGTGTCATGGCG | GAGTGTAAGCGGCCCCCA    c.1140
 I  P  K  G  V  W  R  C  P  K  C  V  M  A   | E  C  K  R  P  P      p.380

          .         .         .         .         .         .       g.18594
 GAAGCCTTTGGCTTTGAGCAGGCTACCCGGGAATACACTCTGCAGAGCTTTGGCGAGATG       c.1200
 E  A  F  G  F  E  Q  A  T  R  E  Y  T  L  Q  S  F  G  E  M         p.400

          .         .         .         .   | 10     .         .    g.18785
 GCCGACTCCTTTAAAGCTGACTACTTCAACATGCCCGTGCAT | ATGGTGCCCACAGAACTT    c.1260
 A  D  S  F  K  A  D  Y  F  N  M  P  V  H   | M  V  P  T  E  L      p.420

          .         .         .         .         .         .       g.18845
 GTGGAGAAGGAGTTCTGGAGGCTGGTAAATAGCATTGAGGAAGATGTGACTGTTGAGTAT       c.1320
 V  E  K  E  F  W  R  L  V  N  S  I  E  E  D  V  T  V  E  Y         p.440

          .         .         .         .         .         .       g.18905
 GGAGCTGACATCCATTCCAAAGAATTTGGCAGCGGTTTCCCTGTCAGTGACAGTAAACGG       c.1380
 G  A  D  I  H  S  K  E  F  G  S  G  F  P  V  S  D  S  K  R         p.460

          .         .  | 11      .         .         .         .    g.19604
 CACCTAACCCCCGAAGAGGAG | GAGTATGCTACCAGTGGTTGGAACCTAAATGTGATGCCG    c.1440
 H  L  T  P  E  E  E   | E  Y  A  T  S  G  W  N  L  N  V  M  P      p.480

          .         .         .         .         .         .       g.19664
 GTGTTGGAACAGTCTGTACTGTGCCACATCAATGCAGATATCTCTGGCATGAAGGTGCCC       c.1500
 V  L  E  Q  S  V  L  C  H  I  N  A  D  I  S  G  M  K  V  P         p.500

          .         .         .         .         .         .       g.19724
 TGGCTCTACGTGGGCATGGTCTTCTCAGCCTTTTGCTGGCATATTGAGGATCACTGGAGT       c.1560
 W  L  Y  V  G  M  V  F  S  A  F  C  W  H  I  E  D  H  W  S         p.520

          .         .    | 12    .         .         .         .    g.19883
 TACTCCATTAACTACCTCCACTG | GGGTGAGCCGAAGACCTGGTATGGGGTGCCCTCACTT    c.1620
 Y  S  I  N  Y  L  H  W  |  G  E  P  K  T  W  Y  G  V  P  S  L      p.540

          .         .         .         .         .         .       g.19943
 GCAGCAGAACATTTGGAAGAAGTGATGAAGAAGCTGACACCTGAACTATTTGATAGCCAG       c.1680
 A  A  E  H  L  E  E  V  M  K  K  L  T  P  E  L  F  D  S  Q         p.560

          .         .         .         .         .         .       g.20003
 CCTGACCTCCTGCACCAACTTGTCACCCTCATGAATCCCAACACCCTCATGTCCCATGGT       c.1740
 P  D  L  L  H  Q  L  V  T  L  M  N  P  N  T  L  M  S  H  G         p.580

        | 13 .         .         .         .         .         .    g.28503
 GTGCCA | GTTGTCCGCACAAACCAGTGTGCAGGAGAGTTTGTCATCACCTTCCCCCGTGCT    c.1800
 V  P   | V  V  R  T  N  Q  C  A  G  E  F  V  I  T  F  P  R  A      p.600

          .         .         .         .         .         .       g.28563
 TACCACAGCGGCTTCAACCAAGGCTACAACTTTGCCGAGGCTGTCAACTTTTGCACTGCT       c.1860
 Y  H  S  G  F  N  Q  G  Y  N  F  A  E  A  V  N  F  C  T  A         p.620

        | 14 .         .         .         .         .         .    g.28732
 GACTGG | TTGCCTGCTGGGCGCCAGTGCATTGAGCACTACCGCCGGCTCCGGAGATACTGC    c.1920
 D  W   | L  P  A  G  R  Q  C  I  E  H  Y  R  R  L  R  R  Y  C      p.640

          .         .         .         .         .         .       g.28792
 GTCTTCTCCCATGAGGAGCTTATCTGCAAGATGGCTGCCTGCCCAGAGAAGCTAGACCTG       c.1980
 V  F  S  H  E  E  L  I  C  K  M  A  A  C  P  E  K  L  D  L         p.660

          .         .         .         .         .         .       g.28852
 AACCTGGCGGCAGCTGTGCATAAGGAGATGTTCATCATGGTGCAAGAAGAGCGGCGTCTA       c.2040
 N  L  A  A  A  V  H  K  E  M  F  I  M  V  Q  E  E  R  R  L         p.680

          .         .  | 15      .         .         .         .    g.31303
 CGAAAGGCCCTGCTGGAGAAG | GGTATCACAGAGGCTGAGCGAGAGGCTTTCGAGCTGCTC    c.2100
 R  K  A  L  L  E  K   | G  I  T  E  A  E  R  E  A  F  E  L  L      p.700

          .         .         .         .         .         .       g.31363
 CCAGATGATGAGCGCCAGTGTATCAAGTGCAAGACTACGTGTTTCCTGTCAGCCCTGGCC       c.2160
 P  D  D  E  R  Q  C  I  K  C  K  T  T  C  F  L  S  A  L  A         p.720

          .         .         .         .         .         .       g.31423
 TGCTACGACTGCCCAGACGGCCTTGTCTGCCTTTCCCACATCAATGATCTCTGCAAGTGC       c.2220
 C  Y  D  C  P  D  G  L  V  C  L  S  H  I  N  D  L  C  K  C         p.740

          .         .    | 16    .         .         .         .    g.31571
 TCCAGTAGCCGGCAGTACCTGCG | GTATCGGTATACCTTGGATGAGCTTCCTGCCATGCTG    c.2280
 S  S  S  R  Q  Y  L  R  |  Y  R  Y  T  L  D  E  L  P  A  M  L      p.760

          .         .         .         .         .         .       g.31631
 CATAAGCTGAAGGTTCGGGCTGAGTCCTTTGACACCTGGGCCAACAAAGTGCGAGTGGCC       c.2340
 H  K  L  K  V  R  A  E  S  F  D  T  W  A  N  K  V  R  V  A         p.780

          .         .         | 17         .         .         .    g.31817
 CTGGAGGTGGAGGATGGGCGGAAGCGCA | GCCTTGAAGAACTGAGGGCACTAGAGTCTGAA    c.2400
 L  E  V  E  D  G  R  K  R  S |   L  E  E  L  R  A  L  E  S  E      p.800

          .         .         .         .         .         .       g.31877
 GCCCGTGAGCGGAGGTTTCCTAATAGTGAGCTGCTGCAGCAACTAAAGAACTGCCTGAGT       c.2460
 A  R  E  R  R  F  P  N  S  E  L  L  Q  Q  L  K  N  C  L  S         p.820

          .         .         .         .         .       | 18 .    g.32550
 GAGGCAGAGGCTTGCGTGTCCCGAGCTCTGGGACTGGTCAGCGGCCAGGAAGCTGG | CCCC    c.2520
 E  A  E  A  C  V  S  R  A  L  G  L  V  S  G  Q  E  A  G  |  P      p.840

          .         .         .         .         .         .       g.32610
 CACAGGGTGGCTGGTCTACAGATGACCCTGACTGAGCTCCGGGCCTTTCTGGACCAGATG       c.2580
 H  R  V  A  G  L  Q  M  T  L  T  E  L  R  A  F  L  D  Q  M         p.860

          .         .         .         .   | 19     .         .    g.33396
 AACAACCTGCCTTGCGCCATGCACCAGATTGGGGATGTCAAG | GGTGTTCTGGAACAGGTG    c.2640
 N  N  L  P  C  A  M  H  Q  I  G  D  V  K   | G  V  L  E  Q  V      p.880

          .         .         .         .         .         .       g.33456
 GAGGCCTACCAGGCTGAGGCTCGTGAGGCCCTGGCCTCACTGCCCTCCAGTCCAGGGCTA       c.2700
 E  A  Y  Q  A  E  A  R  E  A  L  A  S  L  P  S  S  P  G  L         p.900

          .         .         .         .         .         .       g.33516
 CTGCAGTCCCTGTTGGAGAGGGGGCGGCAGCTGGGGGTGGAGGTGCCTGAGGCCCAGCAG       c.2760
 L  Q  S  L  L  E  R  G  R  Q  L  G  V  E  V  P  E  A  Q  Q         p.920

          .         .         .         .         .         .       g.33576
 CTCCAGCGGCAGGTGGAACAGGCGCGATGGCTGGATGAGGTGAAACGCACACTGGCCCCC       c.2820
 L  Q  R  Q  V  E  Q  A  R  W  L  D  E  V  K  R  T  L  A  P         p.940

          .         .         .         .         .         .       g.33636
 TCAGCCCGAAGGGGCACCTTGGCTGTCATGCGAGGACTGTTGGTCGCGGGTGCCAGTGTA       c.2880
 S  A  R  R  G  T  L  A  V  M  R  G  L  L  V  A  G  A  S  V         p.960

          .         .         .         .         .         .       g.33696
 GCCCCTAGCCCTGCTGTGGATAAAGCCCAGGCCGAGCTGCAGGAACTGCTGACCATTGCT       c.2940
 A  P  S  P  A  V  D  K  A  Q  A  E  L  Q  E  L  L  T  I  A         p.980

          .         .         .         .  | 20      .         .    g.34387
 GAACGCTGGGAGGAGAAAGCCCACCTCTGCCTGGAGGCCAG | GCAGAAGCATCCACCAGCC    c.3000
 E  R  W  E  E  K  A  H  L  C  L  E  A  R  |  Q  K  H  P  P  A      p.1000

          .         .         .         .         .         .       g.34447
 ACACTTGAGGCCATAATCCGTGAAGCGGAAAACATCCCTGTTCACCTGCCCAACATCCAG       c.3060
 T  L  E  A  I  I  R  E  A  E  N  I  P  V  H  L  P  N  I  Q         p.1020

          .         .         .         .         .         .       g.34507
 GCTCTCAAGGAGGCTCTTGCTAAGGCCCGGGCCTGGATTGCTGATGTTGATGAGATCCAA       c.3120
 A  L  K  E  A  L  A  K  A  R  A  W  I  A  D  V  D  E  I  Q         p.1040

  | 21       .         .         .         .         .         .    g.35072
  | AATGGTGACCACTACCCCTGCCTGGATGACTTGGAGGGCCTAGTAGCTGTGGGCCGGGAC    c.3180
  | N  G  D  H  Y  P  C  L  D  D  L  E  G  L  V  A  V  G  R  D      p.1060

          .         .         .         .         .         .       g.35132
 CTACCTGTGGGGCTGGAGGAGCTGAGACAGCTAGAGCTACAGGTACTGACAGCGCACTCC       c.3240
 L  P  V  G  L  E  E  L  R  Q  L  E  L  Q  V  L  T  A  H  S         p.1080

          .         .         .         .         .         .       g.35192
 TGGAGGGAGAAGGCCTCCAAGACCTTCCTCAAGAAAAATTCTTGCTACACGCTGCTGGAG       c.3300
 W  R  E  K  A  S  K  T  F  L  K  K  N  S  C  Y  T  L  L  E         p.1100

  | 22       .         .         .         .         .         .    g.35414
  | GTTCTCTGCCCATGTGCAGATGCCGGCTCAGACAGCACCAAGCGCAGCCGGTGGATGGAG    c.3360
  | V  L  C  P  C  A  D  A  G  S  D  S  T  K  R  S  R  W  M  E      p.1120

          .         .         .         .         .         .       g.35474
 AAGGAGCTGGGGTTGTACAAATCTGACACAGAGCTGCTGGGGCTGTCTGCGCAGGACCTC       c.3420
 K  E  L  G  L  Y  K  S  D  T  E  L  L  G  L  S  A  Q  D  L         p.1140

          .         | 23         .         .         .         .    g.35726
 AGGGACCCAGGCTCTGTG | ATCGTGGCCTTCAAGGAGGGGGAACAGAAGGAGAAGGAGGGT    c.3480
 R  D  P  G  S  V   | I  V  A  F  K  E  G  E  Q  K  E  K  E  G      p.1160

          .         .         .         .         .         .       g.35786
 ATCCTGCAGCTGCGTCGCACCAATTCGGCCAAGCCCAGTCCACTGGCATCATCGAGCACG       c.3540
 I  L  Q  L  R  R  T  N  S  A  K  P  S  P  L  A  S  S  S  T         p.1180

          .         .         .         .         .         .       g.35846
 GCCTCCTCTACAACCTCTATCTGTGTGTGTGGGCAGGTGCTGGCTGGGGCGGGAGCTCTG       c.3600
 A  S  S  T  T  S  I  C  V  C  G  Q  V  L  A  G  A  G  A  L         p.1200

          .         .         .         .         .         .       g.35906
 CAGTGTGACCTGTGTCAGGACTGGTTCCATGGGCGGTGTGTGTCAGTGCCTCGCCTCCTC       c.3660
 Q  C  D  L  C  Q  D  W  F  H  G  R  C  V  S  V  P  R  L  L         p.1220

          .         .         .         .         .         .       g.35966
 AGCTCTCCGAGGCCCAATCCCACCTCATCCCCACTGCTGGCCTGGTGGGAATGGGACACC       c.3720
 S  S  P  R  P  N  P  T  S  S  P  L  L  A  W  W  E  W  D  T         p.1240

          .         .         .         .         .         .       g.36026
 AAATTCCTGTGTCCACTGTGTATGCGCTCAAGGCGCCCGCGCCTGGAGACCATCCTGGCA       c.3780
 K  F  L  C  P  L  C  M  R  S  R  R  P  R  L  E  T  I  L  A         p.1260

          .         .         .         .         .         .       g.36086
 CTGCTGGTAGCCCTGCAGAGACTGCCTGTGCGGCTGCCCGAGGGCGAGGCCCTGCAGTGC       c.3840
 L  L  V  A  L  Q  R  L  P  V  R  L  P  E  G  E  A  L  Q  C         p.1280

          .         .         .         .         .         .       g.36146
 CTCACAGAGAGGGCCATCAGCTGGCAAGGCCGCGCCAGGCAGGCTCTGGCCTCTGAAGAT       c.3900
 L  T  E  R  A  I  S  W  Q  G  R  A  R  Q  A  L  A  S  E  D         p.1300

          .         .         .         .         .         .       g.36206
 GTGACTGCTCTTTTGGGACGGCTGGCTGAGCTCCGCCAACGGCTACAGGCTGAACCTAGA       c.3960
 V  T  A  L  L  G  R  L  A  E  L  R  Q  R  L  Q  A  E  P  R         p.1320

          .         .         .         .         .         .       g.36266
 CCTGAGGAGCCTCCTAACTACCCTGCAGCCCCTGCTTCTGACCCCCTCAGAGAGGGCAGT       c.4020
 P  E  E  P  P  N  Y  P  A  A  P  A  S  D  P  L  R  E  G  S         p.1340

          .         | 24         .         .         .         .    g.36613
 GGCAAGGATATGCCTAAG | GTCCAGGGCTTACTGGAGAATGGAGACAGTGTGACCAGTCCT    c.4080
 G  K  D  M  P  K   | V  Q  G  L  L  E  N  G  D  S  V  T  S  P      p.1360

          .         .         .        | 25.         .         .    g.36809
 GAGAAGGTAGCCCCGGAGGAGGGCTCAGGTAAGAGAG | ATCTGGAGCTGCTGTCCTCGCTG    c.4140
 E  K  V  A  P  E  E  G  S  G  K  R  D |   L  E  L  L  S  S  L      p.1380

          .         .         .         .         .         .       g.36869
 TTGCCACAGTTGACTGGCCCTGTGTTGGAACTGCCTGAGGCAACCCGGGCCCCCTTGGAG       c.4200
 L  P  Q  L  T  G  P  V  L  E  L  P  E  A  T  R  A  P  L  E         p.1400

          .         .         .         .         .         .       g.36929
 GAGCTCATGATGGAGGGGGACCTGCTCGAGGTGACCCTGGATGAGAACCACAGCATATGG       c.4260
 E  L  M  M  E  G  D  L  L  E  V  T  L  D  E  N  H  S  I  W         p.1420

          .         .         .         .         .        | 26.    g.37093
 CAGCTGCTGCAGGCTGGACAGCCCCCAGACCTGGAGAGGATCCGCACACTTCTGGAG | CTG    c.4320
 Q  L  L  Q  A  G  Q  P  P  D  L  E  R  I  R  T  L  L  E   | L      p.1440

          .         .         .         .         .         .       g.37153
 GAGAAGGCAGAGCGTCACGGGAGTCGGGCTCGGGGCCGGGCCCTGGAGAGGCGGCGGCGG       c.4380
 E  K  A  E  R  H  G  S  R  A  R  G  R  A  L  E  R  R  R  R         p.1460

          .         .         .         .         .         .       g.37213
 CGGAAGGTGGATCGGGGTGGGGAGGGCGATGACCCAGCCCGAGAGGAGCTAGAGCCAAAG       c.4440
 R  K  V  D  R  G  G  E  G  D  D  P  A  R  E  E  L  E  P  K         p.1480

          .         .         .         .         .         .       g.37273
 AGGGTACGGAGCTCAGGGCCAGAGGCTGAGGAGGTCCAGGAGGAGGAAGAGCTGGAGGAG       c.4500
 R  V  R  S  S  G  P  E  A  E  E  V  Q  E  E  E  E  L  E  E         p.1500

          .         .         .         .         .         .       g.37333
 GAGACTGGGGGTGAGGGCCCCCCTGCACCCATCCCCACCACTGGCAGCCCCAGCACCCAG       c.4560
 E  T  G  G  E  G  P  P  A  P  I  P  T  T  G  S  P  S  T  Q         p.1520

          .         .         .         .         .         .       g.37393
 GAGAACCAGAATGGCTTGGAACCGGCGGAAGGGACCACTTCAGGCCCCTCGGCCCCTTTC       c.4620
 E  N  Q  N  G  L  E  P  A  E  G  T  T  S  G  P  S  A  P  F         p.1540

          .         .         .         .         .         .       g.37453
 TCCACTCTGACTCCCCGGCTGCATCTGCCCTGCCCACAGCAGCCGCCTCAGCAACAGTTG       c.4680
 S  T  L  T  P  R  L  H  L  P  C  P  Q  Q  P  P  Q  Q  Q  L         p.1560

                                                                    g.37456
 TGA                                                                c.4683
 X                                                                  p.1560

          .         .         .         .         .         .       g.37516
 cagtggctgagcctagcacagaccctgacagagacccccctcggcctcaaggatcctctt       c.*60

          .         .         .         .         .         .       g.37576
 tctgaccatcaagcctgcttcttggggggtgggcgggtaggggggtggccatccctgcta       c.*120

          .         .         .         .         .         .       g.37636
 cccgcccacccctgagtcccttgacttttgtattctgactccaaggtattgttcagacct       c.*180

          .         .         .         .         .         .       g.37696
 cagctcctgggggccggcccctggagtcttccctccctggtagcctctaaccagcattcc       c.*240

          .         .         .         .         .         .       g.37756
 cagacacctgaggcagatagatggatgggctggtgggcaggggggtggctggggctgggc       c.*300

          .         .         .         .         .         .       g.37816
 catcaccattccagagacaaggccagtgtatatgcaaactgggggactctcctcccttct       c.*360

          .         .         .         .         .         .       g.37876
 ctccccagttctggtcctggccaggccatgctacactaacccctgcccccactctcctcc       c.*420

          .         .         .         .         .         .       g.37936
 cctcttttccttccttcctacccccttctccctctcccttcccctgactgttccacccag       c.*480

          .         .         .         .         .         .       g.37996
 gaggaggaaacttcacatagccgtgctcacagttttttattttaaaggaatttggctggg       c.*540

          .         .         .         .         .         .       g.38056
 gagctgaacagggctccctgtgatctgaagaaagcttttggtgcttgtcctcacaaccac       c.*600

          .         .         .         .         .         .       g.38116
 ctcagtcctccctccctgtcctcccctgtctcctttcctcctcctgggttcatgttgtaa       c.*660

          .         .         .         .         .         .       g.38176
 taaaagaagattgttggtgtgtaattaatttgttcaaaagaaaaaaaaaagcaaaacaag       c.*720

          .         .         .         .         .         .       g.38236
 aaacttggttccaactgaagcctattttaattttattttattattttcctcttgttagaa       c.*780

          .         .         .         .         .         .       g.38296
 ataaaacccttagaaacattttttggaaacatgtttctgaagtgcatttctcttagacgg       c.*840

          .         .         .         .         .         .       g.38356
 ggaagacagtgcttccatcaccagtcagtggagcagctgtagtgctggcaggagcactag       c.*900

          .         .         .         .         .         .       g.38416
 ggctgaagccagggagctctgggttctgaaatcaagttccaccagcttcttaaccttggg       c.*960

          .         .         .         .         .         .       g.38476
 caagacattctgatcctcccccgactctaaccccaagccactttccctcaagtccaaaca       c.*1020

          .         .         .         .         .         .       g.38536
 gatgggctcgggccccctcacccaaactcctacactacaacctcccccagttgatgccct       c.*1080

          .         .         .         .         .         .       g.38596
 ccagtttatcctcctcaagctcccaaagggatttttttgttaatggctttattgagatat       c.*1140

          .         .         .         .         .         .       g.38656
 aatttacatactataaaattcacttgtttgaaatgtacaattcagtgatttggggggttt       c.*1200

          .         .         .         .         .         .       g.38716
 ctaaagtgtagatctgattatatactgcttaaaaccttccatgatgctttattgccctta       c.*1260

          .         .         .         .         .         .       g.38776
 agattatacatagaatctcgttcttcctagaatgttttcctgtctaacccatctactgca       c.*1320

          .         .         .         .         .         .       g.38836
 taattccctgatttttctccacaggttatgcccctgatgaatggggactaaagctcagat       c.*1380

          .         .         .         .         .         .       g.38896
 gtgtggtcatttgcaacccctgagttcacttttttaagacagcttattgatatatataat       c.*1440

          .         .         .         .         .         .       g.38956
 gtacataccatacagtcacccacttaaaagtatacaattaaatagcttttagtatattca       c.*1500

          .         .         .         .         .         .       g.39016
 gagttgtgcagccatcattcgaaaaaaaatttcagaacattttcatcactgcagaaagaa       c.*1560

          .         .         .         .         .         .       g.39076
 actccatatcccttaggcgtcctttacccctcatcccatttgcctattctggacatttta       c.*1620

          .         .                                               g.39102
 cataaatggaatcgtataatatgtga                                         c.*1646

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Lysine (K)-specific demethylase 5C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center