lysine (K)-specific demethylase 6A (KDM6A) - coding DNA reference sequence

(used for variant description)

(last modified June 10, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_021140.2 in the KDM6A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016260.1, covering KDM6A transcript NM_021140.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5015
                                              gtgacacaattacaa       c.-361

 .         .         .         .         .         .                g.5075
 caactttgtgctggtgccggggaagtttgtgtctccaacgaatcccctcagtgctcccca       c.-301

 .         .         .         .         .         .                g.5135
 gccccgcgcgctccggccgttcccgccgtccccgcctgtggctgccccctgcccaacccc       c.-241

 .         .         .         .         .         .                g.5195
 gcgatgtgaccctacagccgaaagccgccgctgccgacccgggggctccgcagcccctgc       c.-181

 .         .         .         .         .         .                g.5255
 cgccgccgccgccgccttcaccgccgccgcgttgggatttttcgtcgccgccgcccgcgg       c.-121

 .         .         .         .         .         .                g.5315
 cggaggaggaggcggcgataaagttggtgtgctggtcccgcgcgcagattgggggcgtca       c.-61

 .         .         .         .         .         .                g.5375
 ctgcgggccccggtccgagggggggtgtcggcgttggagttgtgaattcgctgcgtttcc       c.-1

          .         .         .         .         .         .       g.5435
 ATGAAATCCTGCGGAGTGTCGCTCGCTACCGCCGCCGCTGCCGCCGCCGCTTTCGGTGAT       c.60
 M  K  S  C  G  V  S  L  A  T  A  A  A  A  A  A  A  F  G  D         p.20

          .         .         .         .         .         .       g.5495
 GAGGAAAAGAAAATGGCGGCGGGAAAAGCGAGCGGCGAGAGCGAGGAGGCGTCCCCCAGC       c.120
 E  E  K  K  M  A  A  G  K  A  S  G  E  S  E  E  A  S  P  S         p.40

          .         .         .         .  | 02      .         .    g.5766
 CTGACAGCCGAGGAGAGGGAGGCGCTCGGCGGACTGGACAG | CCGCCTCTTTGGGTTCGTG    c.180
 L  T  A  E  E  R  E  A  L  G  G  L  D  S  |  R  L  F  G  F  V      p.60

          .         .         .         .      | 03  .         .    g.93121
 AGATTTCATGAAGATGGCGCCAGGACGAAGGCCCTACTGGGCAAG | GCTGTTCGCTGCTAT    c.240
 R  F  H  E  D  G  A  R  T  K  A  L  L  G  K   | A  V  R  C  Y      p.80

          .         .         .         .         .         .       g.93181
 GAATCTCTAATCTTAAAAGCTGAAGGAAAAGTGGAGTCTGATTTCTTTTGTCAATTAGGT       c.300
 E  S  L  I  L  K  A  E  G  K  V  E  S  D  F  F  C  Q  L  G         p.100

          .         .         .     | 04   .         .         .    g.106514
 CACTTCAACCTCTTATTGGAAGATTATCCAAAAG | CATTATCTGCATACCAGAGGTACTAC    c.360
 H  F  N  L  L  L  E  D  Y  P  K  A |   L  S  A  Y  Q  R  Y  Y      p.120

          .         .     | 05   .         .         .         .    g.142819
 AGTTTACAGTCTGACTACTGGAAG | AATGCTGCCTTTTTATATGGTCTTGGTTTGGTCTAC    c.420
 S  L  Q  S  D  Y  W  K   | N  A  A  F  L  Y  G  L  G  L  V  Y      p.140

          .         .    | 06    .         .         .         .    g.152469
 TTCCATTATAATGCATTTCAGTG | GGCAATTAAAGCATTTCAGGAGGTGCTTTATGTTGAT    c.480
 F  H  Y  N  A  F  Q  W  |  A  I  K  A  F  Q  E  V  L  Y  V  D      p.160

          .         .         .         .         .         .       g.152529
 CCCAGCTTTTGTCGAGCCAAGGAAATTCATTTACGACTTGGGCTTATGTTCAAAGTGAAC       c.540
 P  S  F  C  R  A  K  E  I  H  L  R  L  G  L  M  F  K  V  N         p.180

          .         .     | 07   .         .         .         .    g.166789
 ACAGACTATGAGTCTAGTTTAAAG | CATTTTCAGTTAGCTTTGGTTGACTGTAATCCCTGC    c.600
 T  D  Y  E  S  S  L  K   | H  F  Q  L  A  L  V  D  C  N  P  C      p.200

          .          | 08        .         .         .     | 09   . g.183537
 ACTTTGTCCAATGCTGAAA | TTCAATTTCACATTGCCCACTTATATGAAACCCAG | AGGAAA c.660
 T  L  S  N  A  E  I |   Q  F  H  I  A  H  L  Y  E  T  Q   | R  K   p.220

          .         .         .         .         .         .       g.183597
 TATCATTCTGCAAAAGAAGCTTATGAACAACTTTTGCAGACAGAGAATCTTTCTGCACAA       c.720
 Y  H  S  A  K  E  A  Y  E  Q  L  L  Q  T  E  N  L  S  A  Q         p.240

          .         .         | 10         .         .         .    g.185683
 GTAAAAGCAACTGTCTTACAACAGTTAG | GTTGGATGCATCACACTGTAGATCTCCTGGGA    c.780
 V  K  A  T  V  L  Q  Q  L  G |   W  M  H  H  T  V  D  L  L  G      p.260

          .         .         .         .         .         .       g.185743
 GATAAAGCCACCAAGGAAAGCTATGCTATTCAGTATCTCCAAAAGTCCTTGGAAGCAGAT       c.840
 D  K  A  T  K  E  S  Y  A  I  Q  Y  L  Q  K  S  L  E  A  D         p.280

          .         .         .      | 11  .         .         .    g.190853
 CCTAATTCTGGCCAGTCCTGGTATTTCCTCGGAAG | GTGCTATTCAAGTATTGGGAAAGTT    c.900
 P  N  S  G  Q  S  W  Y  F  L  G  R  |  C  Y  S  S  I  G  K  V      p.300

          .         .         .         .         .         .       g.190913
 CAGGATGCCTTTATATCTTACAGGCAGTCTATTGATAAATCAGAAGCAAGTGCAGATACA       c.960
 Q  D  A  F  I  S  Y  R  Q  S  I  D  K  S  E  A  S  A  D  T         p.320

          .     | 12   .         .         .         .         .    g.191115
 TGGTGTTCAATAGG | TGTGCTATATCAGCAGCAAAATCAGCCCATGGATGCTTTACAGGCC    c.1020
 W  C  S  I  G  |  V  L  Y  Q  Q  Q  N  Q  P  M  D  A  L  Q  A      p.340

          .         .         .         .         .         .       g.191175
 TATATTTGTGCTGTACAATTGGACCATGGCCATGCTGCAGCCTGGATGGACCTAGGCACT       c.1080
 Y  I  C  A  V  Q  L  D  H  G  H  A  A  A  W  M  D  L  G  T         p.360

          .         .         .         .         .         .       g.191235
 CTCTATGAATCCTGCAACCAGCCTCAGGATGCCATTAAATGCTACTTAAATGCAACTAGA       c.1140
 L  Y  E  S  C  N  Q  P  Q  D  A  I  K  C  Y  L  N  A  T  R         p.380

          .         .         .         .         .     | 13   .    g.191850
 AGCAAAAGTTGTAGTAATACCTCTGCACTTGCAGCACGAATTAAGTATTTACAG | GCTCAG    c.1200
 S  K  S  C  S  N  T  S  A  L  A  A  R  I  K  Y  L  Q   | A  Q      p.400

          .         .         .         .         .         .       g.191910
 TTGTGTAACCTTCCACAAGGTAGTCTACAGAATAAAACTAAATTACTTCCTAGTATTGAG       c.1260
 L  C  N  L  P  Q  G  S  L  Q  N  K  T  K  L  L  P  S  I  E         p.420

          .         .         .         .         .         .       g.191970
 GAGGCGTGGAGCCTACCAATTCCCGCAGAGCTTACCTCCAGGCAGGGTGCCATGAACACA       c.1320
 E  A  W  S  L  P  I  P  A  E  L  T  S  R  Q  G  A  M  N  T         p.440

           | 14        .         .         .         .         .    g.193197
 GCACAGCAG | AATACTTCTGACAATTGGAGTGGTGGACATGCTGTGTCACATCCTCCAGTA    c.1380
 A  Q  Q   | N  T  S  D  N  W  S  G  G  H  A  V  S  H  P  P  V      p.460

          .         .         .         .      | 15  .         .    g.194484
 CAGCAACAAGCTCATTCATGGTGTTTGACACCACAGAAATTACAG | CATTTGGAACAGCTC    c.1440
 Q  Q  Q  A  H  S  W  C  L  T  P  Q  K  L  Q   | H  L  E  Q  L      p.480

          .         .         .         .         .         .       g.194544
 CGCGCAAATAGAAATAATTTAAATCCAGCACAGAAACTGATGCTGGAACAGCTGGAAAGT       c.1500
 R  A  N  R  N  N  L  N  P  A  Q  K  L  M  L  E  Q  L  E  S         p.500

          .         .        | 16.         .         .         .    g.195277
 CAGTTTGTCTTAATGCAACAACACCAA | ATGAGACCAACAGGAGTTGCACAGGTACGATCT    c.1560
 Q  F  V  L  M  Q  Q  H  Q   | M  R  P  T  G  V  A  Q  V  R  S      p.520

          .         .         .         .         .         .       g.195337
 ACTGGAATTCCTAATGGGCCAACAGCTGACTCATCACTGCCTACAAACTCAGTCTCTGGC       c.1620
 T  G  I  P  N  G  P  T  A  D  S  S  L  P  T  N  S  V  S  G         p.540

          .         .         .         .         .         .       g.195397
 CAGCAGCCACAGCTTGCTCTGACCAGAGTGCCTAGCGTCTCTCAGCCTGGAGTCCGTCCT       c.1680
 Q  Q  P  Q  L  A  L  T  R  V  P  S  V  S  Q  P  G  V  R  P         p.560

          .         .         .         .         .         .       g.195457
 GCCTGCCCTGGGCAGCCTTTGGCCAATGGACCCTTTTCTGCAGGCCATGTTCCCTGTAGC       c.1740
 A  C  P  G  Q  P  L  A  N  G  P  F  S  A  G  H  V  P  C  S         p.580

          .         .         .         .         .         .       g.195517
 ACATCAAGAACGCTGGGAAGTACAGACACTATTTTGATAGGCAATAATCATATAACAGGA       c.1800
 T  S  R  T  L  G  S  T  D  T  I  L  I  G  N  N  H  I  T  G         p.600

          .         .         .         .         .         .       g.195577
 AGTGGAAGTAATGGAAACGTGCCTTACCTGCAGCGAAACGCACTCACTCTACCTCATAAC       c.1860
 S  G  S  N  G  N  V  P  Y  L  Q  R  N  A  L  T  L  P  H  N         p.620

          .         .         .         .         .         .       g.195637
 CGCACAAACCTGACCAGCAGCGCAGAGGAGCCGTGGAAAAACCAACTATCTAACTCCACT       c.1920
 R  T  N  L  T  S  S  A  E  E  P  W  K  N  Q  L  S  N  S  T         p.640

     | 17    .         .         .         .         .         .    g.201458
 CAG | GGGCTTCACAAAGGTCAGAGTTCACATTCGGCAGGTCCTAATGGTGAACGACCTCTC    c.1980
 Q   | G  L  H  K  G  Q  S  S  H  S  A  G  P  N  G  E  R  P  L      p.660

          .         .         .         .         .         .       g.201518
 TCTTCCACTGGGCCTTCCCAGCATCTCCAGGCAGCTGGCTCTGGTATTCAGAATCAGAAC       c.2040
 S  S  T  G  P  S  Q  H  L  Q  A  A  G  S  G  I  Q  N  Q  N         p.680

          .         .         .         .         .         .       g.201578
 GGACATCCCACCCTGCCTAGCAATTCAGTAACACAGGGGGCTGCTCTCAATCACCTCTCC       c.2100
 G  H  P  T  L  P  S  N  S  V  T  Q  G  A  A  L  N  H  L  S         p.700

          .         .         .         .         .         .       g.201638
 TCTCACACTGCTACCTCAGGTGGACAACAAGGCATTACCTTAACCAAAGAGAGCAAGCCT       c.2160
 S  H  T  A  T  S  G  G  Q  Q  G  I  T  L  T  K  E  S  K  P         p.720

          .         .         .         .         .         .       g.201698
 TCAGGAAACATATTGACGGTGCCTGAAACAAGCAGGCACACTGGAGAGACACCTAACAGC       c.2220
 S  G  N  I  L  T  V  P  E  T  S  R  H  T  G  E  T  P  N  S         p.740

          .         .         .         .         .         .       g.201758
 ACTGCCAGTGTCGAGGGACTTCCTAATCATGTCCATCAGATGACGGCAGATGCTGTTTGC       c.2280
 T  A  S  V  E  G  L  P  N  H  V  H  Q  M  T  A  D  A  V  C         p.760

          .         .         .         .         .         .       g.201818
 AGTCCTAGCCATGGAGATTCTAAGTCACCAGGTTTACTAAGTTCAGACAATCCTCAGCTC       c.2340
 S  P  S  H  G  D  S  K  S  P  G  L  L  S  S  D  N  P  Q  L         p.780

          .         .         .         .         .         .       g.201878
 TCTGCCTTGTTGATGGGAAAAGCCAATAACAATGTGGGTACTGGAACCTGTGACAAAGTC       c.2400
 S  A  L  L  M  G  K  A  N  N  N  V  G  T  G  T  C  D  K  V         p.800

          .         .         .         .         .         .       g.201938
 AATAACATCCACCCAGCTGTTCATACAAAGACTGATAACTCTGTTGCCTCTTCACCATCT       c.2460
 N  N  I  H  P  A  V  H  T  K  T  D  N  S  V  A  S  S  P  S         p.820

          .         .         .         .         .         .       g.201998
 TCAGCCATTTCAACAGCAACACCTTCTCCAAAATCCACTGAGCAGACAACCACAAACAGT       c.2520
 S  A  I  S  T  A  T  P  S  P  K  S  T  E  Q  T  T  T  N  S         p.840

          .         .         .         .         .         .       g.202058
 GTTACCAGCCTTAACAGCCCTCACAGTGGGCTACACACAATTAATGGAGAAGGGATGGAA       c.2580
 V  T  S  L  N  S  P  H  S  G  L  H  T  I  N  G  E  G  M  E         p.860

          .         .         .         .         .         .       g.202118
 GAATCTCAGAGCCCCATGAAAACAGATCTGCTTCTGGTTAACCACAAACCTAGTCCACAG       c.2640
 E  S  Q  S  P  M  K  T  D  L  L  L  V  N  H  K  P  S  P  Q         p.880

          .         .         .         .         .         .       g.202178
 ATCATACCATCAATGTCTGTGTCCATATACCCCAGCTCAGCAGAAGTTCTGAAGGCATGC       c.2700
 I  I  P  S  M  S  V  S  I  Y  P  S  S  A  E  V  L  K  A  C         p.900

    | 18     .         .         .         .         .         .    g.208577
 AG | GAATCTAGGTAAAAATGGCTTATCTAACAGTAGCATTTTGTTGGATAAATGTCCACCT    c.2760
 R  |  N  L  G  K  N  G  L  S  N  S  S  I  L  L  D  K  C  P  P      p.920

          .         .         .         .         .         .       g.208637
 CCAAGACCACCATCTTCACCATACCCTCCCTTGCCAAAGGACAAGTTGAATCCACCTACA       c.2820
 P  R  P  P  S  S  P  Y  P  P  L  P  K  D  K  L  N  P  P  T         p.940

          .   | 19     .         .         .         .         .    g.210270
 CCTAGTATTTAC | TTGGAAAATAAACGTGATGCTTTCTTTCCTCCATTACATCAATTTTGT    c.2880
 P  S  I  Y   | L  E  N  K  R  D  A  F  F  P  P  L  H  Q  F  C      p.960

          .         .         .         .         .         | 20    g.210970
 ACAAATCCGAACAACCCTGTTACAGTAATACGTGGCCTTGCTGGAGCTCTTAAGTTAG | AC    c.2940
 T  N  P  N  N  P  V  T  V  I  R  G  L  A  G  A  L  K  L  D |       p.980

          .         .         .         .         .         .       g.211030
 CTGGGACTTTTCTCTACTAAAACTTTGGTGGAAGCTAACAATGAACATATGGTAGAAGTG       c.3000
 L  G  L  F  S  T  K  T  L  V  E  A  N  N  E  H  M  V  E  V         p.1000

          .         .         .         .         .         .       g.211090
 AGGACACAGTTGTTGCAGCCAGCAGATGAAAACTGGGATCCCACTGGAACAAAGAAAATC       c.3060
 R  T  Q  L  L  Q  P  A  D  E  N  W  D  P  T  G  T  K  K  I         p.1020

          .         .         .         .         .         .       g.211150
 TGGCATTGTGAAAGTAATAGATCTCATACTACAATTGCTAAATATGCACAGTACCAGGCC       c.3120
 W  H  C  E  S  N  R  S  H  T  T  I  A  K  Y  A  Q  Y  Q  A         p.1040

          .         .     | 21   .         .         .         .    g.214434
 TCCTCATTCCAGGAATCATTGAGA | GAAGAAAATGAAAAAAGAAGTCATCATAAAGACCAC    c.3180
 S  S  F  Q  E  S  L  R   | E  E  N  E  K  R  S  H  H  K  D  H      p.1060

          .         .          | 22        .         .         .    g.214568
 TCAGATAGTGAATCTACATCGTCAGATAA | TTCTGGGAGGAGGAGGAAAGGACCCTTTAAA    c.3240
 S  D  S  E  S  T  S  S  D  N  |  S  G  R  R  R  K  G  P  F  K      p.1080

          .         .         .         .     | 23   .         .    g.215298
 ACCATAAAGTTTGGGACCAATATTGACCTATCTGATGACAAAAA | GTGGAAGTTGCAGCTA    c.3300
 T  I  K  F  G  T  N  I  D  L  S  D  D  K  K  |  W  K  L  Q  L      p.1100

          .         .         .         .         .         .       g.215358
 CATGAGCTGACTAAACTTCCTGCTTTTGTGCGTGTCGTATCAGCAGGAAATCTTCTAAGC       c.3360
 H  E  L  T  K  L  P  A  F  V  R  V  V  S  A  G  N  L  L  S         p.1120

          .         .         .         .         .         .       g.215418
 CATGTTGGTCATACCATATTGGGCATGAACACAGTTCAACTATACATGAAAGTTCCAGGG       c.3420
 H  V  G  H  T  I  L  G  M  N  T  V  Q  L  Y  M  K  V  P  G         p.1140

          .    | 24    .         .         .         .         .    g.217734
 AGCAGAACACCAG | GTCATCAGGAAAATAACAACTTCTGTTCAGTTAACATAAATATTGGC    c.3480
 S  R  T  P  G |   H  Q  E  N  N  N  F  C  S  V  N  I  N  I  G      p.1160

          .         .         .         .         .         .       g.217794
 CCAGGTGACTGTGAATGGTTTGTTGTTCCTGAAGGTTACTGGGGTGTTCTGAATGACTTC       c.3540
 P  G  D  C  E  W  F  V  V  P  E  G  Y  W  G  V  L  N  D  F         p.1180

          | 25         .         .         .         .         .    g.221617
 TGTGAAAA | AAATAATTTGAATTTCCTAATGGGTTCTTGGTGGCCCAATCTTGAAGATCTT    c.3600
 C  E  K  |  N  N  L  N  F  L  M  G  S  W  W  P  N  L  E  D  L      p.1200

          .         .         .         .         .         .       g.221677
 TATGAAGCAAATGTTCCAGTGTATAGGTTTATTCAGCGACCTGGAGATTTGGTCTGGATA       c.3660
 Y  E  A  N  V  P  V  Y  R  F  I  Q  R  P  G  D  L  V  W  I         p.1220

          .         .         .         .         .         .       g.221737
 AATGCAGGCACTGTTCATTGGGTTCAGGCTATTGGCTGGTGCAACAACATTGCTTGGAAT       c.3720
 N  A  G  T  V  H  W  V  Q  A  I  G  W  C  N  N  I  A  W  N         p.1240

          .       | 26 .         .         .         .         .    g.222589
 GTTGGTCCACTTACAG | CCTGCCAGTATAAATTGGCAGTGGAACGGTACGAATGGAACAAA    c.3780
 V  G  P  L  T  A |   C  Q  Y  K  L  A  V  E  R  Y  E  W  N  K      p.1260

          .         .         .         .         .         .       g.222649
 TTGCAAAGTGTGAAGTCAATAGTACCCATGGTTCATCTTTCCTGGAATATGGCACGAAAT       c.3840
 L  Q  S  V  K  S  I  V  P  M  V  H  L  S  W  N  M  A  R  N         p.1280

          .         .         .         | 27         .         .    g.239254
 ATCAAGGTCTCAGATCCAAAGCTTTTTGAAATGATTAA | GTATTGTCTTCTAAGAACTCTG    c.3900
 I  K  V  S  D  P  K  L  F  E  M  I  K  |  Y  C  L  L  R  T  L      p.1300

          .         .         .         .         .         .       g.239314
 AAGCAATGTCAGACATTGAGGGAAGCTCTCATTGCTGCAGGAAAAGAGATTATATGGCAT       c.3960
 K  Q  C  Q  T  L  R  E  A  L  I  A  A  G  K  E  I  I  W  H         p.1320

          .         .         .         .      | 28  .         .    g.241916
 GGGCGGACAAAAGAAGAACCAGCTCATTACTGTAGCATTTGTGAA | GTGGAGGTTTTTGAT    c.4020
 G  R  T  K  E  E  P  A  H  Y  C  S  I  C  E   | V  E  V  F  D      p.1340

          .         .         .         .         .         .       g.241976
 CTGCTTTTTGTCACTAATGAGAGTAATTCACGAAAGACCTACATAGTACATTGCCAAGAT       c.4080
 L  L  F  V  T  N  E  S  N  S  R  K  T  Y  I  V  H  C  Q  D         p.1360

          .         .         .         .         .         .       g.242036
 TGTGCACGAAAAACAAGCGGAAACTTGGAAAACTTTGTGGTGCTAGAACAGTACAAAATG       c.4140
 C  A  R  K  T  S  G  N  L  E  N  F  V  V  L  E  Q  Y  K  M         p.1380

          .         .         .       | 29 .         .         .    g.243228
 GAGGACCTGATGCAAGTCTATGACCAATTTACATTA | GCTCCTCCATTACCATCCGCCTCA    c.4200
 E  D  L  M  Q  V  Y  D  Q  F  T  L   | A  P  P  L  P  S  A  S      p.1400

                                                                    g.243234
 TCTTGA                                                             c.4206
 S  X                                                               p.1401

          .         .         .         .         .         .       g.243294
 tattgttccatggacattaaatgagaccttttctgctattcaggaaataacccagttctg       c.*60

          .         .         .         .         .         .       g.243354
 caccactggtttttgtagctatctcgtaaggctgctggctgaaaactgtgtctatgcaac       c.*120

          .         .         .         .         .         .       g.243414
 cttccaagtgcggagtgtcaaccaactggacgggagagagtactgctcctactccaggac       c.*180

          .         .         .         .         .         .       g.243474
 tctcacaaagctgatgagctgtacttcagaaaaaaataataatttccatgttttgtatat       c.*240

          .         .         .         .         .         .       g.243534
 atctgacaaaactggcaacatcttacagactactgacttgaagacaacctcttttatatt       c.*300

          .         .         .         .         .         .       g.243594
 tctctatttctgggctgatgaatttgttttcatctgtcttttcccccttcagaattttcc       c.*360

          .         .         .         .         .         .       g.243654
 ttggaaaaaaaatactagcctagctggtcatttctttgtaaggtagttagcaattttaag       c.*420

          .         .         .         .         .         .       g.243714
 tctttctttggtcaacttttttttaatgtgaaaagttaggtaagacacttttttactgct       c.*480

          .         .         .         .         .         .       g.243774
 tttatgtttttctgtcttgttttgagaccatgatggttacacttttggttcctaaataaa       c.*540

          .         .         .         .         .         .       g.243834
 atttaaaaaattaacagccaagtcacaaaggtaatggattgcacatagactaaggaataa       c.*600

          .         .         .         .         .         .       g.243894
 acttcagatttgtgatttttgtttctaatcttgatgtaaatttacactatttataaatac       c.*660

          .         .         .         .         .         .       g.243954
 atatttattgcttgaaaatatttgtgaatggaatgctgttattttttccagatttacctg       c.*720

          .         .         .         .         .         .       g.244014
 ccattgaaattttaaggagttctgtaatttcaaacactactcctattacattttctatgt       c.*780

          .         .         .         .         .         .       g.244074
 gtaaataaaactgcttagcattgtacagaaacttttattaaaattgtttaatgtttaaag       c.*840

          .         .         .         .         .         .       g.244134
 agttttctattgtttgagttttaaaaaagactttatgtacagtgcccagtttttgttcat       c.*900

          .         .         .         .         .         .       g.244194
 ttttgaaatctgattatatatattttatatatacttatgtatgtatatataatatatata       c.*960

          .         .         .         .         .         .       g.244254
 gaaatctggatatatatgtataaatctttagaacttaaatttttctcgttttaagtttca       c.*1020

          .         .         .         .         .         .       g.244314
 catctatggtagatttttgaggtgtctactgtaaagtattgcttacaaaaagtatgatta       c.*1080

          .         .         .         .         .         .       g.244374
 tttttaaagaaatatatatggtatgtatcctcaagacctaaaatgtcagactggtttatt       c.*1140

          .         .         .         .         .                 g.244425
 gttaagttgcaattactgcaatgacagaccaataaacaattgctgccaaaa                c.*1191

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Lysine (K)-specific demethylase 6A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 15
©2004-2016 Leiden University Medical Center