v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) - coding DNA reference sequence

(used for variant description)

(last modified March 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_004985.3 in the KRAS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007524.1, covering KRAS transcript NM_004985.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5001
                                                            g       c.-181

 .         .         .         .         .         .                g.5061
 gccgcggcggcggaggcagcagcggcggcggcagtggcggcggcgaaggtggcggcggct       c.-121

 .         .         .         .         .         .                g.5121
 cggccagtactcccggcccccgccatttcggactgggagcgagcgcggcgcaggcactga       c.-61

 .         .         .         .         .         | 02             g.10536
 aggcggcggcggggccagaggctcagcggctcccaggtgcgggagagag | gcctgctgaaa    c.-1

          .         .         .         .         .         .       g.10596
 ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACG       c.60
 M  T  E  Y  K  L  V  V  V  G  A  G  G  V  G  K  S  A  L  T         p.20

          .         .         .         .         .  | 03      .    g.28517
 ATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG | GATTCCTAC    c.120
 I  Q  L  I  Q  N  H  F  V  D  E  Y  D  P  T  I  E   | D  S  Y      p.40

          .         .         .         .         .         .       g.28577
 AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT       c.180
 R  K  Q  V  V  I  D  G  E  T  C  L  L  D  I  L  D  T  A  G         p.60

          .         .         .         .         .         .       g.28637
 CAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGT       c.240
 Q  E  E  Y  S  A  M  R  D  Q  Y  M  R  T  G  E  G  F  L  C         p.80

          .         .         .         .         . | 04       .    g.30157
 GTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAG | AGAACAAATT    c.300
 V  F  A  I  N  N  T  K  S  F  E  D  I  H  H  Y  R  |  E  Q  I      p.100

          .         .         .         .         .         .       g.30217
 AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTG       c.360
 K  R  V  K  D  S  E  D  V  P  M  V  L  V  G  N  K  C  D  L         p.120

          .         .         .         .         .         .       g.30277
 CCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT       c.420
 P  S  R  T  V  D  T  K  Q  A  Q  D  L  A  R  S  Y  G  I  P         p.140

          .         .         . | 05       .         .         .    g.46039
 TTTATTGAAACATCAGCAAAGACAAGACAG | GGTGTTGATGATGCCTTCTATACATTAGTT    c.480
 F  I  E  T  S  A  K  T  R  Q   | G  V  D  D  A  F  Y  T  L  V      p.160

          .         .         .         .         .         .       g.46099
 CGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAG       c.540
 R  E  I  R  K  H  K  E  K  M  S  K  D  G  K  K  K  K  K  K         p.180

          .         .                                               g.46126
 TCAAAGACAAAGTGTGTAATTATGTAA                                        c.567
 S  K  T  K  C  V  I  M  X                                          p.188

          .         .         .         .         .         .       g.46186
 atacaatttgtacttttttcttaaggcatactagtacaagtggtaatttttgtacattac       c.*60

          .         .         .         .         .         .       g.46246
 actaaattattagcatttgttttagcattacctaatttttttcctgctccatgcagactg       c.*120

          .         .         .         .         .         .       g.46306
 ttagcttttaccttaaatgcttattttaaaatgacagtggaagtttttttttcctctaag       c.*180

          .         .         .         .         .         .       g.46366
 tgccagtattcccagagttttggtttttgaactagcaatgcctgtgaaaaagaaactgaa       c.*240

          .         .         .         .         .         .       g.46426
 tacctaagatttctgtcttggggcttttggtgcatgcagttgattacttcttatttttct       c.*300

          .         .         .         .         .         .       g.46486
 taccaattgtgaatgttggtgtgaaacaaattaatgaagcttttgaatcatccctattct       c.*360

          .         .         .         .         .         .       g.46546
 gtgttttatctagtcacataaatggattaattactaatttcagttgagaccttctaattg       c.*420

          .         .         .         .         .         .       g.46606
 gtttttactgaaacattgagggaacacaaatttatgggcttcctgatgatgattcttcta       c.*480

          .         .         .         .         .         .       g.46666
 ggcatcatgtcctatagtttgtcatccctgatgaatgtaaagttacactgttcacaaagg       c.*540

          .         .         .         .         .         .       g.46726
 ttttgtctcctttccactgctattagtcatggtcactctccccaaaatattatatttttt       c.*600

          .         .         .         .         .         .       g.46786
 ctataaaaagaaaaaaatggaaaaaaattacaaggcaatggaaactattataaggccatt       c.*660

          .         .         .         .         .         .       g.46846
 tccttttcacattagataaattactataaagactcctaatagcttttcctgttaaggcag       c.*720

          .         .         .         .         .         .       g.46906
 acccagtatgaaatggggattattatagcaaccattttggggctatatttacatgctact       c.*780

          .         .         .         .         .         .       g.46966
 aaatttttataataattgaaaagattttaacaagtataaaaaattctcataggaattaaa       c.*840

          .         .         .         .         .         .       g.47026
 tgtagtctccctgtgtcagactgctctttcatagtataactttaaatcttttcttcaact       c.*900

          .         .         .         .         .         .       g.47086
 tgagtctttgaagatagttttaattctgcttgtgacattaaaagattatttgggccagtt       c.*960

          .         .         .         .         .         .       g.47146
 atagcttattaggtgttgaagagaccaaggttgcaaggccaggccctgtgtgaacctttg       c.*1020

          .         .         .         .         .         .       g.47206
 agctttcatagagagtttcacagcatggactgtgtccccacggtcatccagtgttgtcat       c.*1080

          .         .         .         .         .         .       g.47266
 gcattggttagtcaaaatggggagggactagggcagtttggatagctcaacaagatacaa       c.*1140

          .         .         .         .         .         .       g.47326
 tctcactctgtggtggtcctgctgacaaatcaagagcattgcttttgtttcttaagaaaa       c.*1200

          .         .         .         .         .         .       g.47386
 caaactcttttttaaaaattacttttaaatattaactcaaaagttgagattttggggtgg       c.*1260

          .         .         .         .         .         .       g.47446
 tggtgtgccaagacattaattttttttttaaacaatgaagtgaaaaagttttacaatctc       c.*1320

          .         .         .         .         .         .       g.47506
 taggtttggctagttctcttaacactggttaaattaacattgcataaacacttttcaagt       c.*1380

          .         .         .         .         .         .       g.47566
 ctgatccatatttaataatgctttaaaataaaaataaaaacaatccttttgataaattta       c.*1440

          .         .         .         .         .         .       g.47626
 aaatgttacttattttaaaataaatgaagtgagatggcatggtgaggtgaaagtatcact       c.*1500

          .         .         .         .         .         .       g.47686
 ggactaggaagaaggtgacttaggttctagataggtgtcttttaggactctgattttgag       c.*1560

          .         .         .         .         .         .       g.47746
 gacatcacttactatccatttcttcatgttaaaagaagtcatctcaaactcttagttttt       c.*1620

          .         .         .         .         .         .       g.47806
 tttttttacaactatgtaatttatattccatttacataaggatacacttatttgtcaagc       c.*1680

          .         .         .         .         .         .       g.47866
 tcagcacaatctgtaaatttttaacctatgttacaccatcttcagtgccagtcttgggca       c.*1740

          .         .         .         .         .         .       g.47926
 aaattgtgcaagaggtgaagtttatatttgaatatccattctcgttttaggactcttctt       c.*1800

          .         .         .         .         .         .       g.47986
 ccatattagtgtcatcttgcctccctaccttccacatgccccatgacttgatgcagtttt       c.*1860

          .         .         .         .         .         .       g.48046
 aatacttgtaattcccctaaccataagatttactgctgctgtggatatctccatgaagtt       c.*1920

          .         .         .         .         .         .       g.48106
 ttcccactgagtcacatcagaaatgccctacatcttatttcctcagggctcaagagaatc       c.*1980

          .         .         .         .         .         .       g.48166
 tgacagataccataaagggatttgacctaatcactaattttcaggtggtggctgatgctt       c.*2040

          .         .         .         .         .         .       g.48226
 tgaacatctctttgctgcccaatccattagcgacagtaggatttttcaaacctggtatga       c.*2100

          .         .         .         .         .         .       g.48286
 atagacagaaccctatccagtggaaggagaatttaataaagatagtgctgaaagaattcc       c.*2160

          .         .         .         .         .         .       g.48346
 ttaggtaatctataactaggactactcctggtaacagtaatacattccattgttttagta       c.*2220

          .         .         .         .         .         .       g.48406
 accagaaatcttcatgcaatgaaaaatactttaattcatgaagcttactttttttttttg       c.*2280

          .         .         .         .         .         .       g.48466
 gtgtcagagtctcgctcttgtcacccaggctggaatgcagtggcgccatctcagctcact       c.*2340

          .         .         .         .         .         .       g.48526
 gcaacctccatctcccaggttcaagcgattctcgtgcctcggcctcctgagtagctggga       c.*2400

          .         .         .         .         .         .       g.48586
 ttacaggcgtgtgccactacactcaactaatttttgtatttttaggagagacggggtttc       c.*2460

          .         .         .         .         .         .       g.48646
 accctgttggccaggctggtctcgaactcctgacctcaagtgattcacccaccttggcct       c.*2520

          .         .         .         .         .         .       g.48706
 cataaacctgttttgcagaactcatttattcagcaaatatttattgagtgcctaccagat       c.*2580

          .         .         .         .         .         .       g.48766
 gccagtcaccacacaaggcactgggtatatggtatccccaaacaagagacataatcccgg       c.*2640

          .         .         .         .         .         .       g.48826
 tccttaggtagtgctagtgtggtctgtaatatcttactaaggcctttggtatacgaccca       c.*2700

          .         .         .         .         .         .       g.48886
 gagataacacgatgcgtattttagttttgcaaagaaggggtttggtctctgtgccagctc       c.*2760

          .         .         .         .         .         .       g.48946
 tataattgttttgctacgattccactgaaactcttcgatcaagctactttatgtaaatca       c.*2820

          .         .         .         .         .         .       g.49006
 cttcattgttttaaaggaataaacttgattatattgtttttttatttggcataactgtga       c.*2880

          .         .         .         .         .         .       g.49066
 ttcttttaggacaattactgtacacattaaggtgtatgtcagatattcatattgacccaa       c.*2940

          .         .         .         .         .         .       g.49126
 atgtgtaatattccagttttctctgcataagtaattaaaatatacttaaaaattaatagt       c.*3000

          .         .         .         .         .         .       g.49186
 tttatctgggtacaaataaacaggtgcctgaactagttcacagacaaggaaacttctatg       c.*3060

          .         .         .         .         .         .       g.49246
 taaaaatcactatgatttctgaattgctatgtgaaactacagatctttggaacactgttt       c.*3120

          .         .         .         .         .         .       g.49306
 aggtagggtgttaagacttacacagtacctcgtttctacacagagaaagaaatggccata       c.*3180

          .         .         .         .         .         .       g.49366
 cttcaggaactgcagtgcttatgaggggatatttaggcctcttgaatttttgatgtagat       c.*3240

          .         .         .         .         .         .       g.49426
 gggcatttttttaaggtagtggttaattacctttatgtgaactttgaatggtttaacaaa       c.*3300

          .         .         .         .         .         .       g.49486
 agatttgtttttgtagagattttaaagggggagaattctagaaataaatgttacctaatt       c.*3360

          .         .         .         .         .         .       g.49546
 attacagccttaaagacaaaaatccttgttgaagtttttttaaaaaaagctaaattacat       c.*3420

          .         .         .         .         .         .       g.49606
 agacttaggcattaacatgtttgtggaagaatatagcagacgtatattgtatcatttgag       c.*3480

          .         .         .         .         .         .       g.49666
 tgaatgttcccaagtaggcattctaggctctatttaactgagtcacactgcataggaatt       c.*3540

          .         .         .         .         .         .       g.49726
 tagaacctaacttttataggttatcaaaactgttgtcaccattgcacaattttgtcctaa       c.*3600

          .         .         .         .         .         .       g.49786
 tatatacatagaaactttgtggggcatgttaagttacagtttgcacaagttcatctcatt       c.*3660

          .         .         .         .         .         .       g.49846
 tgtattccattgattttttttttcttctaaacattttttcttcaaacagtatataacttt       c.*3720

          .         .         .         .         .         .       g.49906
 ttttaggggatttttttttagacagcaaaaactatctgaagatttccatttgtcaaaaag       c.*3780

          .         .         .         .         .         .       g.49966
 taatgatttcttgataattgtgtagtaatgttttttagaacccagcagttaccttaaagc       c.*3840

          .         .         .         .         .         .       g.50026
 tgaatttatatttagtaacttctgtgttaatactggatagcatgaattctgcattgagaa       c.*3900

          .         .         .         .         .         .       g.50086
 actgaatagctgtcataaaatgaaactttctttctaaagaaagatactcacatgagttct       c.*3960

          .         .         .         .         .         .       g.50146
 tgaagaatagtcataactagattaagatctgtgttttagtttaatagtttgaagtgcctg       c.*4020

          .         .         .         .         .         .       g.50206
 tttgggataatgataggtaatttagatgaatttaggggaaaaaaaagttatctgcagata       c.*4080

          .         .         .         .         .         .       g.50266
 tgttgagggcccatctctccccccacacccccacagagctaactgggttacagtgtttta       c.*4140

          .         .         .         .         .         .       g.50326
 tccgaaagtttccaattccactgtcttgtgttttcatgttgaaaatacttttgcattttt       c.*4200

          .         .         .         .         .         .       g.50386
 cctttgagtgccaatttcttactagtactatttcttaatgtaacatgtttacctggaatg       c.*4260

          .         .         .         .         .         .       g.50446
 tattttaactatttttgtatagtgtaaactgaaacatgcacattttgtacattgtgcttt       c.*4320

          .         .         .         .         .         .       g.50506
 cttttgtgggacatatgcagtgtgatccagttgttttccatcatttggttgcgctgacct       c.*4380

          .         .         .         .         .         .       g.50566
 aggaatgttggtcatatcaaacattaaaaatgaccactcttttaattgaaattaactttt       c.*4440

          .         .         .         .         .         .       g.50626
 aaatgtttataggagtatgtgctgtgaagtgatctaaaatttgtaatatttttgtcatga       c.*4500

          .         .         .         .                           g.50675
 actgtactactcctaattattgtaatgtaataaaaatagttacagtgac                  c.*4549

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center