v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) - coding DNA reference sequence

(used for variant description)

(last modified March 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_033360.2 in the KRAS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007524.1, covering KRAS transcript NM_033360.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5001
                                                            g       c.-181

 .         .         .         .         .         .                g.5061
 gccgcggcggcggaggcagcagcggcggcggcagtggcggcggcgaaggtggcggcggct       c.-121

 .         .         .         .         .         .                g.5121
 cggccagtactcccggcccccgccatttcggactgggagcgagcgcggcgcaggcactga       c.-61

 .         .         .         .         .         | 02             g.10536
 aggcggcggcggggccagaggctcagcggctcccaggtgcgggagagag | gcctgctgaaa    c.-1

          .         .         .         .         .         .       g.10596
 ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACG       c.60
 M  T  E  Y  K  L  V  V  V  G  A  G  G  V  G  K  S  A  L  T         p.20

          .         .         .         .         .  | 03      .    g.28517
 ATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG | GATTCCTAC    c.120
 I  Q  L  I  Q  N  H  F  V  D  E  Y  D  P  T  I  E   | D  S  Y      p.40

          .         .         .         .         .         .       g.28577
 AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT       c.180
 R  K  Q  V  V  I  D  G  E  T  C  L  L  D  I  L  D  T  A  G         p.60

          .         .         .         .         .         .       g.28637
 CAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGT       c.240
 Q  E  E  Y  S  A  M  R  D  Q  Y  M  R  T  G  E  G  F  L  C         p.80

          .         .         .         .         . | 04       .    g.30157
 GTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAG | AGAACAAATT    c.300
 V  F  A  I  N  N  T  K  S  F  E  D  I  H  H  Y  R  |  E  Q  I      p.100

          .         .         .         .         .         .       g.30217
 AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTG       c.360
 K  R  V  K  D  S  E  D  V  P  M  V  L  V  G  N  K  C  D  L         p.120

          .         .         .         .         .         .       g.30277
 CCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT       c.420
 P  S  R  T  V  D  T  K  Q  A  Q  D  L  A  R  S  Y  G  I  P         p.140

          .         .         . | 05       .         .         .    g.40390
 TTTATTGAAACATCAGCAAAGACAAGACAG | AGAGTGGAGGATGCTTTTTATACATTGGTG    c.480
 F  I  E  T  S  A  K  T  R  Q   | R  V  E  D  A  F  Y  T  L  V      p.160

          .         .         .         .         .         .       g.40450
 AGGGAGATCCGACAATACAGATTGAAAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGT       c.540
 R  E  I  R  Q  Y  R  L  K  K  I  S  K  E  E  K  T  P  G  C         p.180

          .         .         .                                 g.40480
 GTGAAAATTAAAAAATGCATTATAATGTAA |                                  c.571
 V  K  I  K  K  C  I  I  M  X                                    p.189

      | 06   .         .         .         .         .         .    g.46065
 tctg | ggtgttgatgatgccttctatacattagttcgagaaattcgaaaacataaagaaaa    c.*60

          .         .         .         .         .         .       g.46125
 gatgagcaaagatggtaaaaagaagaaaaagaagtcaaagacaaagtgtgtaattatgta       c.*120

          .         .         .         .         .         .       g.46185
 aatacaatttgtacttttttcttaaggcatactagtacaagtggtaatttttgtacatta       c.*180

          .         .         .         .         .         .       g.46245
 cactaaattattagcatttgttttagcattacctaatttttttcctgctccatgcagact       c.*240

          .         .         .         .         .         .       g.46305
 gttagcttttaccttaaatgcttattttaaaatgacagtggaagtttttttttcctctaa       c.*300

          .         .         .         .         .         .       g.46365
 gtgccagtattcccagagttttggtttttgaactagcaatgcctgtgaaaaagaaactga       c.*360

          .         .         .         .         .         .       g.46425
 atacctaagatttctgtcttggggcttttggtgcatgcagttgattacttcttatttttc       c.*420

          .         .         .         .         .         .       g.46485
 ttaccaattgtgaatgttggtgtgaaacaaattaatgaagcttttgaatcatccctattc       c.*480

          .         .         .         .         .         .       g.46545
 tgtgttttatctagtcacataaatggattaattactaatttcagttgagaccttctaatt       c.*540

          .         .         .         .         .         .       g.46605
 ggtttttactgaaacattgagggaacacaaatttatgggcttcctgatgatgattcttct       c.*600

          .         .         .         .         .         .       g.46665
 aggcatcatgtcctatagtttgtcatccctgatgaatgtaaagttacactgttcacaaag       c.*660

          .         .         .         .         .         .       g.46725
 gttttgtctcctttccactgctattagtcatggtcactctccccaaaatattatattttt       c.*720

          .         .         .         .         .         .       g.46785
 tctataaaaagaaaaaaatggaaaaaaattacaaggcaatggaaactattataaggccat       c.*780

          .         .         .         .         .         .       g.46845
 ttccttttcacattagataaattactataaagactcctaatagcttttcctgttaaggca       c.*840

          .         .         .         .         .         .       g.46905
 gacccagtatgaaatggggattattatagcaaccattttggggctatatttacatgctac       c.*900

          .         .         .         .         .         .       g.46965
 taaatttttataataattgaaaagattttaacaagtataaaaaattctcataggaattaa       c.*960

          .         .         .         .         .         .       g.47025
 atgtagtctccctgtgtcagactgctctttcatagtataactttaaatcttttcttcaac       c.*1020

          .         .         .         .         .         .       g.47085
 ttgagtctttgaagatagttttaattctgcttgtgacattaaaagattatttgggccagt       c.*1080

          .         .         .         .         .         .       g.47145
 tatagcttattaggtgttgaagagaccaaggttgcaaggccaggccctgtgtgaaccttt       c.*1140

          .         .         .         .         .         .       g.47205
 gagctttcatagagagtttcacagcatggactgtgtccccacggtcatccagtgttgtca       c.*1200

          .         .         .         .         .         .       g.47265
 tgcattggttagtcaaaatggggagggactagggcagtttggatagctcaacaagataca       c.*1260

          .         .         .         .         .         .       g.47325
 atctcactctgtggtggtcctgctgacaaatcaagagcattgcttttgtttcttaagaaa       c.*1320

          .         .         .         .         .         .       g.47385
 acaaactcttttttaaaaattacttttaaatattaactcaaaagttgagattttggggtg       c.*1380

          .         .         .         .         .         .       g.47445
 gtggtgtgccaagacattaattttttttttaaacaatgaagtgaaaaagttttacaatct       c.*1440

          .         .         .         .         .         .       g.47505
 ctaggtttggctagttctcttaacactggttaaattaacattgcataaacacttttcaag       c.*1500

          .         .         .         .         .         .       g.47565
 tctgatccatatttaataatgctttaaaataaaaataaaaacaatccttttgataaattt       c.*1560

          .         .         .         .         .         .       g.47625
 aaaatgttacttattttaaaataaatgaagtgagatggcatggtgaggtgaaagtatcac       c.*1620

          .         .         .         .         .         .       g.47685
 tggactaggaagaaggtgacttaggttctagataggtgtcttttaggactctgattttga       c.*1680

          .         .         .         .         .         .       g.47745
 ggacatcacttactatccatttcttcatgttaaaagaagtcatctcaaactcttagtttt       c.*1740

          .         .         .         .         .         .       g.47805
 ttttttttacaactatgtaatttatattccatttacataaggatacacttatttgtcaag       c.*1800

          .         .         .         .         .         .       g.47865
 ctcagcacaatctgtaaatttttaacctatgttacaccatcttcagtgccagtcttgggc       c.*1860

          .         .         .         .         .         .       g.47925
 aaaattgtgcaagaggtgaagtttatatttgaatatccattctcgttttaggactcttct       c.*1920

          .         .         .         .         .         .       g.47985
 tccatattagtgtcatcttgcctccctaccttccacatgccccatgacttgatgcagttt       c.*1980

          .         .         .         .         .         .       g.48045
 taatacttgtaattcccctaaccataagatttactgctgctgtggatatctccatgaagt       c.*2040

          .         .         .         .         .         .       g.48105
 tttcccactgagtcacatcagaaatgccctacatcttatttcctcagggctcaagagaat       c.*2100

          .         .         .         .         .         .       g.48165
 ctgacagataccataaagggatttgacctaatcactaattttcaggtggtggctgatgct       c.*2160

          .         .         .         .         .         .       g.48225
 ttgaacatctctttgctgcccaatccattagcgacagtaggatttttcaaacctggtatg       c.*2220

          .         .         .         .         .         .       g.48285
 aatagacagaaccctatccagtggaaggagaatttaataaagatagtgctgaaagaattc       c.*2280

          .         .         .         .         .         .       g.48345
 cttaggtaatctataactaggactactcctggtaacagtaatacattccattgttttagt       c.*2340

          .         .         .         .         .         .       g.48405
 aaccagaaatcttcatgcaatgaaaaatactttaattcatgaagcttacttttttttttt       c.*2400

          .         .         .         .         .         .       g.48465
 ggtgtcagagtctcgctcttgtcacccaggctggaatgcagtggcgccatctcagctcac       c.*2460

          .         .         .         .         .         .       g.48525
 tgcaacctccatctcccaggttcaagcgattctcgtgcctcggcctcctgagtagctggg       c.*2520

          .         .         .         .         .         .       g.48585
 attacaggcgtgtgccactacactcaactaatttttgtatttttaggagagacggggttt       c.*2580

          .         .         .         .         .         .       g.48645
 caccctgttggccaggctggtctcgaactcctgacctcaagtgattcacccaccttggcc       c.*2640

          .         .         .         .         .         .       g.48705
 tcataaacctgttttgcagaactcatttattcagcaaatatttattgagtgcctaccaga       c.*2700

          .         .         .         .         .         .       g.48765
 tgccagtcaccacacaaggcactgggtatatggtatccccaaacaagagacataatcccg       c.*2760

          .         .         .         .         .         .       g.48825
 gtccttaggtagtgctagtgtggtctgtaatatcttactaaggcctttggtatacgaccc       c.*2820

          .         .         .         .         .         .       g.48885
 agagataacacgatgcgtattttagttttgcaaagaaggggtttggtctctgtgccagct       c.*2880

          .         .         .         .         .         .       g.48945
 ctataattgttttgctacgattccactgaaactcttcgatcaagctactttatgtaaatc       c.*2940

          .         .         .         .         .         .       g.49005
 acttcattgttttaaaggaataaacttgattatattgtttttttatttggcataactgtg       c.*3000

          .         .         .         .         .         .       g.49065
 attcttttaggacaattactgtacacattaaggtgtatgtcagatattcatattgaccca       c.*3060

          .         .         .         .         .         .       g.49125
 aatgtgtaatattccagttttctctgcataagtaattaaaatatacttaaaaattaatag       c.*3120

          .         .         .         .         .         .       g.49185
 ttttatctgggtacaaataaacaggtgcctgaactagttcacagacaaggaaacttctat       c.*3180

          .         .         .         .         .         .       g.49245
 gtaaaaatcactatgatttctgaattgctatgtgaaactacagatctttggaacactgtt       c.*3240

          .         .         .         .         .         .       g.49305
 taggtagggtgttaagacttacacagtacctcgtttctacacagagaaagaaatggccat       c.*3300

          .         .         .         .         .         .       g.49365
 acttcaggaactgcagtgcttatgaggggatatttaggcctcttgaatttttgatgtaga       c.*3360

          .         .         .         .         .         .       g.49425
 tgggcatttttttaaggtagtggttaattacctttatgtgaactttgaatggtttaacaa       c.*3420

          .         .         .         .         .         .       g.49485
 aagatttgtttttgtagagattttaaagggggagaattctagaaataaatgttacctaat       c.*3480

          .         .         .         .         .         .       g.49545
 tattacagccttaaagacaaaaatccttgttgaagtttttttaaaaaaagctaaattaca       c.*3540

          .         .         .         .         .         .       g.49605
 tagacttaggcattaacatgtttgtggaagaatatagcagacgtatattgtatcatttga       c.*3600

          .         .         .         .         .         .       g.49665
 gtgaatgttcccaagtaggcattctaggctctatttaactgagtcacactgcataggaat       c.*3660

          .         .         .         .         .         .       g.49725
 ttagaacctaacttttataggttatcaaaactgttgtcaccattgcacaattttgtccta       c.*3720

          .         .         .         .         .         .       g.49785
 atatatacatagaaactttgtggggcatgttaagttacagtttgcacaagttcatctcat       c.*3780

          .         .         .         .         .         .       g.49845
 ttgtattccattgattttttttttcttctaaacattttttcttcaaacagtatataactt       c.*3840

          .         .         .         .         .         .       g.49905
 tttttaggggatttttttttagacagcaaaaactatctgaagatttccatttgtcaaaaa       c.*3900

          .         .         .         .         .         .       g.49965
 gtaatgatttcttgataattgtgtagtaatgttttttagaacccagcagttaccttaaag       c.*3960

          .         .         .         .         .         .       g.50025
 ctgaatttatatttagtaacttctgtgttaatactggatagcatgaattctgcattgaga       c.*4020

          .         .         .         .         .         .       g.50085
 aactgaatagctgtcataaaatgaaactttctttctaaagaaagatactcacatgagttc       c.*4080

          .         .         .         .         .         .       g.50145
 ttgaagaatagtcataactagattaagatctgtgttttagtttaatagtttgaagtgcct       c.*4140

          .         .         .         .         .         .       g.50205
 gtttgggataatgataggtaatttagatgaatttaggggaaaaaaaagttatctgcagat       c.*4200

          .         .         .         .         .         .       g.50265
 atgttgagggcccatctctccccccacacccccacagagctaactgggttacagtgtttt       c.*4260

          .         .         .         .         .         .       g.50325
 atccgaaagtttccaattccactgtcttgtgttttcatgttgaaaatacttttgcatttt       c.*4320

          .         .         .         .         .         .       g.50385
 tcctttgagtgccaatttcttactagtactatttcttaatgtaacatgtttacctggaat       c.*4380

          .         .         .         .         .         .       g.50445
 gtattttaactatttttgtatagtgtaaactgaaacatgcacattttgtacattgtgctt       c.*4440

          .         .         .         .         .         .       g.50505
 tcttttgtgggacatatgcagtgtgatccagttgttttccatcatttggttgcgctgacc       c.*4500

          .         .         .         .         .         .       g.50565
 taggaatgttggtcatatcaaacattaaaaatgaccactcttttaattgaaattaacttt       c.*4560

          .         .         .         .         .         .       g.50625
 taaatgtttataggagtatgtgctgtgaagtgatctaaaatttgtaatatttttgtcatg       c.*4620

          .         .         .         .         .                 g.50675
 aactgtactactcctaattattgtaatgtaataaaaatagttacagtgac                 c.*4670

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center